BBa_K119001 1 LacZ prom Mutated LacZ promoter 2008-09-27T11:00:00Z 2015-05-08T01:09:38Z Lac Operon from E. coli. Constitutive weak promoter of lacZ which sequence was changed at position 29 (T->G) in order to make it weaker false false _235_ 0 3054 9 Not in stock false We needed two version of it. false Miguel Angel Ram??rez-Romero annotation1977487 1 s_mutation range1977487 1 29 29 annotation1976842 1 LacZ prom mut range1976842 1 1 38 BBa_K119001_sequence 1 tttacactttatgcttccggctcgtatggtgtgtggac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z