BBa_K119004 1 BBa_K119004 Upper primer for aiiA with normal lacZ promoter 2008-09-28T11:00:00Z 2015-05-08T01:09:38Z Designed for aiiA in the part BBa_I729006 Upper primer used to add lacZ promoter to aiiA in the device LuxR_cI_aiiA_Normal lacZ promoter false false _235_ 0 3054 9 Not in stock false LacZ addition which is not present in the original BBa_I729006 part. false Mart??n del Castillo Velasco annotation1977496 1 BBa_K119000 range1977496 1 1 37 annotation1977495 1 aiiA upper primer range1977495 1 1 67 BBa_K119004_sequence 1 tttacactttatgcttccggctcgtatgttgtgtggacctagagaaagaggagaaatactagatgac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z