BBa_K119005 1 Primer aii Upper primer for aiiA with mutated lacZ promoter 2008-09-28T11:00:00Z 2015-05-08T01:09:38Z The part was designed to add a constitutive weak promoter to aiiA in the device BBa_I729006 pper primer used to add a mutated version of lacZ promoter to aiiA in the device LuxR_cI_aiiA_Normal lacZ promoter false false _235_ 0 3054 9 Not in stock false Mutant design and promoter addition to the sequence. false Mart??n del Castillo Velasco annotation1977494 1 BBa_K119001 range1977494 1 1 38 annotation1977492 1 LacZ prom mut range1977492 1 1 38 annotation1977493 1 s_mutation range1977493 1 29 29 BBa_K119005_sequence 1 tttacactttatgcttccggctcgtatggtgtgtggacctagagaaagaggagaaatactagatgac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z