BBa_K119007 1 Up RcnA Upper primer for RcnA 2008-09-28T11:00:00Z 2015-05-08T01:09:38Z Genomic DNA from E.coli and cI promoter. Upper primer used to add cI promoter upstream of the RcnR operator in the device cI+AVGreg_RcnRop_RcnA() false false _235_ 0 3054 9 Not in stock false A prediction of the RcnR operator site was used to construct this part, we needed a repressor to control it, so we added the cI promoter upstream of the RcnR operator. false Libertad Pantoja annotation1977482 1 BBa_R0051 range1977482 1 1 49 annotation1977486 1 -10 range1977486 1 38 43 annotation1977484 1 -35 range1977484 1 15 20 annotation1977485 1 OR1 range1977485 1 25 41 annotation1977483 1 OR2 range1977483 1 1 17 BBa_K119007_sequence 1 taacaccgtgcgtgttgactattttacctctggcggtgataatggttgccactattaatctactggggggtag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z