BBa_K119008 1 BBa_K119008 Lower primer for RcnA (BBa_K119003) 2008-09-28T11:00:00Z 2015-05-08T01:09:38Z Includes just the end of the RcnA coding region from E.coli. Lower primer for RcnA (BBa_K119003). Includes just the end of the RcnA coding region. false false _235_ 0 3054 9 Not in stock false To just get the protein sequence false Libertad Pantoja annotation1977497 1 Lower RcnA primer range1977497 1 1 21 BBa_K119008_sequence 1 agttatcgcattatgcccatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z