BBa_K1194000 1 BBa_K1194000 pLuxR --> ompF --> Gb3 mimic 2013-09-22T11:00:00Z 2015-05-08T01:09:38Z ompF signal peptide is derived from Escherichia coli. Gb3 mimic peptide is a synthetic peptide which comes from a peptide library. pLuxR is a previous Registry part. Gb3 mimic codes for a nine-amino acid peptide that has anti-Shiga toxin activity. It is coded downstream of ompF which is an periplasmic translocation signal peptide. The entire assembly is under control of an N-acyl homoserine lactone (AHL) dependent pLuxR promoter. The part, when translated, produces the Gb3 mimic peptide. The ompF signal peptide helps to transport Gb3 mimic into the extracellular space. Gb3 mimic neutralises the Shiga toxin by binding to it and sequestering it. Other teams can utilise the ompF signal peptide if they want to ensure extracellular secretion of their protein of interest, especially if it is a small peptide. The Gb3 mimic peptide, though specific for the Shiga toxin, can be used for toxicology studies in general. Particularly, it can be of use to create a peptide library to investigate anti-toxin activities of therapeutic peptides by molecular docking. false false _1508_ 0 16858 9 It's complicated true We had the amino acid sequence of the Gb3 mimic. Since we wanted to express our peptide in Escherichia coli (N99 strain), we performed codon-optimisation on the Gb3 mimic DNA before designing the construct. false Rohan Bendre, Aman Kumar, Namit Holay, Mitan Sutradhar, Kanishka Waghmare, Nishita Mohan, Nandita Damaraju, Mayank Choudhary annotation2359354 1 BBa_B0010 range2359354 1 870 949 annotation2359355 1 BBa_B0015 range2359355 1 870 998 annotation2359362 1 LuxR/HSL range2359362 1 1007 1026 annotation2359349 1 BBa_C0062 range2359349 1 81 836 annotation2359364 1 -10 range2359364 1 1048 1053 annotation2359348 1 prefix range2359348 1 81 82 annotation2359347 1 conserved range2359347 1 67 70 annotation2359360 1 stop range2359360 1 991 991 annotation2359366 1 BBa_F2620 range2359366 1 1 1061 annotation2359358 1 T7 TE range2359358 1 965 984 annotation2359363 1 -35 range2359363 1 1026 1031 annotation2359352 1 A range2359352 1 572 572 annotation2359353 1 Help:Barcodes range2359353 1 837 861 annotation2359361 1 BBa_R0062 range2359361 1 1007 1061 annotation2359359 1 polya range2359359 1 985 998 annotation2359341 1 BBa_R0040 range2359341 1 1 54 annotation2359351 1 T range2359351 1 254 254 annotation2359357 1 BBa_B0012 range2359357 1 958 998 annotation2359346 1 BBa_B0034 range2359346 1 63 74 annotation2359356 1 stem_loop range2359356 1 881 924 annotation2359343 1 -35 range2359343 1 20 25 annotation2359344 1 TetR 2 range2359344 1 26 44 annotation2359365 1 start range2359365 1 1059 1059 annotation2359342 1 TetR 1 range2359342 1 1 19 annotation2359350 1 luxR range2359350 1 81 830 annotation2359345 1 -10 range2359345 1 43 48 BBa_K1194000_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagaggagaaatactagatgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaaaaagaggagaaattcagtcatgatgaaacgtaatattctggcagttattgttccggcactgctggttgcaggtaccgcaaatgcatggcattggacctggctgagcgaatattaaccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctcacactggctcaccttcgggtgggccttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z