BBa_K1196004 1 BBa_K1196004 Hydrazine oxidoreductase 2013-08-25T11:00:00Z 2015-05-08T01:09:38Z "Community structures of anammox bacteria and their similar distribution with nirS-encoding nitrite-reducing bacteria in surface sediment of the South China Sea." Li M., Hong Y., Cao H., Gu J. Submitted (NOV-2010) to the EMBL/GenBank/DDBJ databases Cited for: NUCLEOTIDE SEQUENCE. Reaction(IUBMB) hydrazine + acceptor = N2 + reduced acceptor The enzyme is involved in the pathway of anaerobic ammonium oxidation in anammox bacteria. The conversion of hydroxylamine by the enzyme from Brocadia anammoxidans results in the formation of NO and N2O [1]. Hydroxylamine is not a substrate for the enzyme from planctomycete KSU-1 false false _1510_ 0 18361 9 Not in stock false Reaction(IUBMB) hydrazine + acceptor = N2 + reduced acceptor false Sheng Ding BBa_K1196004_sequence 1 atgtcaaatgcagacagaggtgcgcctctctggaaggaaaagagagacacctgggtatcagtatgtgacgattgccattcaccaaggtttgcaagagagaacttgcaggcgatggacgaagcttgtaaggatgcaggtctgaagtatactgaaacgtttaaagtagcagagaatttgatgcttgatggtatgggcgagcctatgcctaaggatcttcatcctgactggagtggtcagcacatctggagtttgaagattggtgcttatcatgatggaccgaagtatggtggtaagaagggtgagtccggtgagttcagaatgtctaactgttcagacatagaaagagtatgttttgagagcgttggatactggatgacttacatattcaagggaatggcgcatggttcatggaacgatgcgacatattgtgacgggtcgtttggtatggac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z