BBa_K1196011 1 BBa_K1196011 Hydrazine synthetase 2013-09-09T11:00:00Z 2015-05-08T01:09:38Z Reference: Han P., Klumper U., Wong A.C.F., Li M., Lin J.G., Quan Z.X., Ford T., Gu J.D. Submitted (26-MAR-2012) to the INSDC. School of Biological Sciences, The University of Hong Kong, Kadoorie Biological Sciences Building, Hong Kong, China The genomic sequence of this part comes from uncultured anaerobic ammonium-oxidizing bacterium. Hydrazine synthetase, a unique phylomarker with which to study the presence and biodiversity of anammox bacteria.The tested hydrazine synthetase were able to retrieve hzsA gene sequences from anammox enrichment cultures, full-scale anammox wastewater treatment systems, and a variety of freshwater and marine environmental samples, covering all known anammox genera. false false _1510_ 0 18793 9 Not in stock false Hydrazine synthetase, a unique phylomarker with which to study the presence and biodiversity of anammox bacteria.The tested hydrazine synthetase were able to retrieve hzsA gene sequences from anammox enrichment cultures, full-scale anammox wastewater treatment systems, and a variety of freshwater and marine environmental samples, covering all known anammox genera. false Chao Sun BBa_K1196011_sequence 1 gggtatcagtatgtagaggatgatggttcaaccgttacctcacagttggcagacgtaccgtattacatccagattctggatgacaagggtatgtccgtacagacgggtttatcctgggcatacttaaggccgtatcatggtaggattggatgtcactatggatcatatcgtggaagggcatttaagaatttgcat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z