BBa_K1196011 1 BBa_K1196011 Hydrazine synthetase 2013-09-09T11:00:00Z 2015-05-08T01:09:38Z Reference: Han P., Klumper U., Wong A.C.F., Li M., Lin J.G., Quan Z.X., Ford T., Gu J.D. Submitted (26-MAR-2012) to the INSDC. School of Biological Sciences, The University of Hong Kong, Kadoorie Biological Sciences Building, Hong Kong, China The genomic sequence of this part comes from uncultured anaerobic ammonium-oxidizing bacterium. Hydrazine synthetase, a unique phylomarker with which to study the presence and biodiversity of anammox bacteria.The tested hydrazine synthetase were able to retrieve hzsA gene sequences from anammox enrichment cultures, full-scale anammox wastewater treatment systems, and a variety of freshwater and marine environmental samples, covering all known anammox genera. false false _1510_ 0 18793 9 Not in stock false Hydrazine synthetase, a unique phylomarker with which to study the presence and biodiversity of anammox bacteria.The tested hydrazine synthetase were able to retrieve hzsA gene sequences from anammox enrichment cultures, full-scale anammox wastewater treatment systems, and a variety of freshwater and marine environmental samples, covering all known anammox genera. false Chao Sun BBa_K1196019 1 BBa_K1196019 hydrazine synthetase device 2013-09-15T11:00:00Z 2015-05-08T01:09:39Z anammox This part can synthesize hydrazine synthetase. false false _1510_ 0 18361 9 Not in stock false This part can synthesize hydrazine synthetase. false Sheng Ding component2346850 1 BBa_J23100 component2346855 1 BBa_B0010 component2346852 1 BBa_B0030 component2346857 1 BBa_B0012 component2346854 1 BBa_K1196011 annotation2346855 1 BBa_B0010 range2346855 1 270 349 annotation2346850 1 BBa_J23100 range2346850 1 1 35 annotation2346854 1 BBa_K1196011 range2346854 1 67 261 annotation2346852 1 BBa_B0030 range2346852 1 44 58 annotation2346857 1 BBa_B0012 range2346857 1 358 398 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1702 1 RBS range1702 1 8 12 annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1701 1 RBS-1\Strong range1701 1 1 15 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_K1196011_sequence 1 gggtatcagtatgtagaggatgatggttcaaccgttacctcacagttggcagacgtaccgtattacatccagattctggatgacaagggtatgtccgtacagacgggtttatcctgggcatacttaaggccgtatcatggtaggattggatgtcactatggatcatatcgtggaagggcatttaagaatttgcat BBa_B0030_sequence 1 attaaagaggagaaa BBa_K1196019_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagattaaagaggagaaatactagaggggtatcagtatgtagaggatgatggttcaaccgttacctcacagttggcagacgtaccgtattacatccagattctggatgacaagggtatgtccgtacagacgggtttatcctgggcatacttaaggccgtatcatggtaggattggatgtcactatggatcatatcgtggaagggcatttaagaatttgcattactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z