BBa_J23101 1 BBa_J23101 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z later Released HQ 2013 later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1196004 1 BBa_K1196004 Hydrazine oxidoreductase 2013-08-25T11:00:00Z 2015-05-08T01:09:38Z "Community structures of anammox bacteria and their similar distribution with nirS-encoding nitrite-reducing bacteria in surface sediment of the South China Sea." Li M., Hong Y., Cao H., Gu J. Submitted (NOV-2010) to the EMBL/GenBank/DDBJ databases Cited for: NUCLEOTIDE SEQUENCE. Reaction(IUBMB) hydrazine + acceptor = N2 + reduced acceptor The enzyme is involved in the pathway of anaerobic ammonium oxidation in anammox bacteria. The conversion of hydroxylamine by the enzyme from Brocadia anammoxidans results in the formation of NO and N2O [1]. Hydroxylamine is not a substrate for the enzyme from planctomycete KSU-1 false false _1510_ 0 18361 9 Not in stock false Reaction(IUBMB) hydrazine + acceptor = N2 + reduced acceptor false Sheng Ding BBa_K1196020 1 BBa_K1196020 hydrazine oxidoreductase device 2013-09-15T11:00:00Z 2015-05-08T01:09:39Z anammox This part synthesize hydrazine oxidoreductase. false false _1510_ 0 18361 9 It's complicated false This part synthesize hydrazine oxidoreductase. false Sheng Ding component2346873 1 BBa_B0031 component2346874 1 BBa_K1196004 component2346875 1 BBa_B0010 component2346871 1 BBa_J23101 component2346877 1 BBa_B0012 annotation2346871 1 BBa_J23101 range2346871 1 1 35 annotation2346877 1 BBa_B0012 range2346877 1 610 650 annotation2346874 1 BBa_K1196004 range2346874 1 64 513 annotation2346875 1 BBa_B0010 range2346875 1 522 601 annotation2346873 1 BBa_B0031 range2346873 1 44 57 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_B0031 1 BBa_B0031 RBS.2 (weak) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Medium RBS based on Ron Weiss thesis. Strength considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false <P> <P>Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-1&quot; in figure 4-14 of thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Cho</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23316 1 conserved range23316 1 7 10 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1196020_sequence 1 tttacagctagctcagtcctaggtattatgctagctactagagtcacacaggaaacctactagatgtcaaatgcagacagaggtgcgcctctctggaaggaaaagagagacacctgggtatcagtatgtgacgattgccattcaccaaggtttgcaagagagaacttgcaggcgatggacgaagcttgtaaggatgcaggtctgaagtatactgaaacgtttaaagtagcagagaatttgatgcttgatggtatgggcgagcctatgcctaaggatcttcatcctgactggagtggtcagcacatctggagtttgaagattggtgcttatcatgatggaccgaagtatggtggtaagaagggtgagtccggtgagttcagaatgtctaactgttcagacatagaaagagtatgttttgagagcgttggatactggatgacttacatattcaagggaatggcgcatggttcatggaacgatgcgacatattgtgacgggtcgtttggtatggactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1196004_sequence 1 atgtcaaatgcagacagaggtgcgcctctctggaaggaaaagagagacacctgggtatcagtatgtgacgattgccattcaccaaggtttgcaagagagaacttgcaggcgatggacgaagcttgtaaggatgcaggtctgaagtatactgaaacgtttaaagtagcagagaatttgatgcttgatggtatgggcgagcctatgcctaaggatcttcatcctgactggagtggtcagcacatctggagtttgaagattggtgcttatcatgatggaccgaagtatggtggtaagaagggtgagtccggtgagttcagaatgtctaactgttcagacatagaaagagtatgttttgagagcgttggatactggatgacttacatattcaagggaatggcgcatggttcatggaacgatgcgacatattgtgacgggtcgtttggtatggac BBa_B0031_sequence 1 tcacacaggaaacc BBa_J23101_sequence 1 tttacagctagctcagtcctaggtattatgctagc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z