BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1710 1 RBS range1710 1 7 10 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_J23102 1 BBa_J23102 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z isolated from library of promoters Released HQ 2013 replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1196014 1 BBa_K1196014 formate dehydrogenase 2013-09-09T11:00:00Z 2015-05-08T01:09:38Z Authors DAVISON DC. Title Studies on plant formic dehydrogenase. Journal Biochem. J. 49 (1951) 520-6. Organism Phaseolus vulgaris Oxidoreductases;Acting on the aldehyde or oxo group of donors;With NAD+ or NADP+ as acceptor. The enzyme from most aerobic organisms is devoid of redox-active centres but that from the proteobacterium Methylosinus trichosporium contains iron-sulfur centres, flavin and a molybdenum centre [3]. Together with EC 1.12.1.2 hydrogen dehydrogenase, forms a system previously known as formate hydrogenlyase. false false _1510_ 0 18792 9 Not in stock false Oxidoreductases;Acting on the aldehyde or oxo group of donors;With NAD+ or NADP+ as acceptor. The enzyme from most aerobic organisms is devoid of redox-active centres but that from the proteobacterium Methylosinus trichosporium contains iron-sulfur centres, flavin and a molybdenum centre [3]. Together with EC 1.12.1.2 hydrogen dehydrogenase, forms a system previously known as formate hydrogenlyase. false Tao Sun BBa_K1196021 1 BBa_K1196021 Formate dehydrogenase device 2013-09-15T11:00:00Z 2015-05-08T01:09:39Z anammox This part synthesize formate dehydrogenase. false false _1510_ 0 18361 9 Not in stock false This part synthesize formate dehydrogenase. false Sheng Ding component2346889 1 BBa_B0032 component2346894 1 BBa_B0012 component2346892 1 BBa_B0010 component2346887 1 BBa_J23102 component2346891 1 BBa_K1196014 annotation2346891 1 BBa_K1196014 range2346891 1 65 407 annotation2346887 1 BBa_J23102 range2346887 1 1 35 annotation2346892 1 BBa_B0010 range2346892 1 416 495 annotation2346889 1 BBa_B0032 range2346889 1 44 56 annotation2346894 1 BBa_B0012 range2346894 1 504 544 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0032_sequence 1 tcacacaggaaag BBa_J23102_sequence 1 ttgacagctagctcagtcctaggtactgtgctagc BBa_K1196021_sequence 1 ttgacagctagctcagtcctaggtactgtgctagctactagagtcacacaggaaagtactagagctcctatagggcgaattgggccctgcatgctcgagcggccgccagtgtgatggatataattcgcccttcattccaaaatgttgtttgacattgatacaggctagagaggaggcctaaatgtgagtaaagtttgtctttcaccatacatagttttcactgagtaaagcacgatggaacaacttgaatgtgtcttcattgaaactgctgctctgaggctacagaatgccagaacggtagaaaaaacgatttccggtttcaggggacgatatcttagcaaggccagtgtttgaagagggtgccaaaacagtgaaagttcatttaccgggtaaagacgagtattggttactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1196014_sequence 1 ctcctatagggcgaattgggccctgcatgctcgagcggccgccagtgtgatggatataattcgcccttcattccaaaatgttgtttgacattgatacaggctagagaggaggcctaaatgtgagtaaagtttgtctttcaccatacatagttttcactgagtaaagcacgatggaacaacttgaatgtgtcttcattgaaactgctgctctgaggctacagaatgccagaacggtagaaaaaacgatttccggtttcaggggacgatatcttagcaaggccagtgtttgaagagggtgccaaaacagtgaaagttcatttaccgggtaaagacgagtattggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z