BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K1196013 1 BBa_K1196013 NADH:ubiquinone reductase (H+-translocating) 2013-09-09T11:00:00Z 2015-05-08T01:09:38Z Hatefi, Y., Ragan, C.I. and Galante, Y.M. The enzymes and the enzyme complexes of the mitochondrial oxidative phosphorylation system. In: Martonosi, A. (Ed.), The Enzymes of Biological Membranes, 2nd ed., vol. 4, Plenum Press, New York, 1985, p. 1-70. Oxidoreductases; Acting on NADH or NADPH; With a quinone or similar compound as acceptor. false false _1510_ 0 18792 9 Not in stock false Oxidoreductases; Acting on NADH or NADPH; With a quinone or similar compound as acceptor. false Tao Sun BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1702 1 RBS range1702 1 8 12 annotation1701 1 RBS-1\Strong range1701 1 1 15 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1196022 1 BBa_K1196022 NADH:ubiquinone reductase (H+-translocating) Device 2013-09-15T11:00:00Z 2015-05-08T01:09:39Z anammox This part synthesize ubiquinone reductase. false false _1510_ 0 18361 9 Not in stock false This part synthesize ubiquinone reductase. false Sheng Ding component2346898 1 BBa_J23100 component2346902 1 BBa_K1196013 component2346905 1 BBa_B0012 component2346903 1 BBa_B0010 component2346900 1 BBa_B0030 annotation2346903 1 BBa_B0010 range2346903 1 912 991 annotation2346905 1 BBa_B0012 range2346905 1 1000 1040 annotation2346902 1 BBa_K1196013 range2346902 1 67 903 annotation2346900 1 BBa_B0030 range2346900 1 44 58 annotation2346898 1 BBa_J23100 range2346898 1 1 35 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_K1196022_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagattaaagaggagaaatactagagctttcatcctttttccattacttacctcaatacatcatgtcaaatatacatatatatatactcatatgtaattcaaattcaaacaatcaataaccgaaataaacctaatacgaacttacttaaacaaaacagcaacaggcactacactgaggactactcgacttttttttttcgcggttattgaccggttgatccattttttcatctatgtaatagtttaactcaattaaccaattcaaataccttaaaatatctaaattcatgtatttgaccttttaacaacattttacattattaccctaaacttttaacttttattcaatttaatctctaaatctaaaacttacacatttattacaatcgagcccaatatatgctagccaaattctccttaacactcctatagctctcaattaatgatattttcacaagaatttcaccttaatttttttattttatcattttagtccctaaactttaaactaactaaatttactttacaaaataatcctatttaacaacaaacttataaacctatcatttaacttcaaaaatatcaaaaatcatcaatggcaaatttcaaaacctttgacaattttacaaaatagtccctgagttagctagattaagctgcaacaatttaaaaaacgggctttagattcactcacatgcatagatcgattgtttggagaagtttgaagctttcctaatcccctcctatggctttcgagcagtggaaagatgaagatggcaaccatttctctttctttccaccttaattcatttttaattactattattttcattatttatttatttatcattttcaacaaaatttactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0030_sequence 1 attaaagaggagaaa BBa_K1196013_sequence 1 ctttcatcctttttccattacttacctcaatacatcatgtcaaatatacatatatatatactcatatgtaattcaaattcaaacaatcaataaccgaaataaacctaatacgaacttacttaaacaaaacagcaacaggcactacactgaggactactcgacttttttttttcgcggttattgaccggttgatccattttttcatctatgtaatagtttaactcaattaaccaattcaaataccttaaaatatctaaattcatgtatttgaccttttaacaacattttacattattaccctaaacttttaacttttattcaatttaatctctaaatctaaaacttacacatttattacaatcgagcccaatatatgctagccaaattctccttaacactcctatagctctcaattaatgatattttcacaagaatttcaccttaatttttttattttatcattttagtccctaaactttaaactaactaaatttactttacaaaataatcctatttaacaacaaacttataaacctatcatttaacttcaaaaatatcaaaaatcatcaatggcaaatttcaaaacctttgacaattttacaaaatagtccctgagttagctagattaagctgcaacaatttaaaaaacgggctttagattcactcacatgcatagatcgattgtttggagaagtttgaagctttcctaatcccctcctatggctttcgagcagtggaaagatgaagatggcaaccatttctctttctttccaccttaattcatttttaattactattattttcattatttatttatttatcattttcaacaaaatt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z