BBa_K1197000 1 BBa_K1197000 Anti MazF - Antisense RNA to inhibit MazF activity in B.subtilis 2013-09-19T11:00:00Z 2015-06-08T11:15:20Z It is synthesized as a reverse complementary sequence to MazF (K302033) Anti MazF is an antisense RNA producing sequence which is complemantary to MazF (K302033). MazF is a non-specific ribonuclease coding element which kills Bacillus subtilis. Anti MazF element produces an mRNA which is reverse complemantary to mRNA produced by MazF. Thus, Anti Mazf mRNA binds to MazF mRNA and inhibit its activity for coding MazF protein. false false _1511_ 4206 12727 9 In stock false This part is designed as a complemantary sequence to the last 4 bases of the RBS sequence, 6 bases to the intermediate region and to the first 40 bases of MazF coding sequence, tottally 50 bases. false Alişan Kayab??len BBa_K1197000_sequence 1 aaatcagatcgcccatatcgggtacgtatcggcttaccatctagtattca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z