BBa_K606040 1 pHS Promoter Hyperspank B.subtilis & E.coli 2011-09-17T11:00:00Z 2015-05-08T01:12:51Z inspired from the part BBa_K143015 Released HQ 2013 Promoter hyper-spank is an inducible promoter that has been designed for high expression in B.subtilis. Gene expression under the control of the promoter hyper-spank can be induced by addition of Isopropyl β-D-1-thiogalactopyranoside (IPTG). false false _778_ 0 8931 9 In stock false DNA synthesis false Axel S??guret annotation2138639 1 LacO range2138639 1 72 92 annotation2138638 1 -10 range2138638 1 60 65 annotation2138637 1 -35 range2138637 1 37 41 annotation2138636 1 Lac0 range2138636 1 1 21 BBa_K1197002 1 BBa_K1197002 pHyperspank + Anti MazF 2013-09-19T11:00:00Z 2015-06-08T11:15:51Z It is synthesized as a reverse complementary sequence to MazF (K302033) Anti MazF is an antisense RNA producing sequence which is complemantary to MazF (K302033). MazF is a non-specific ribonuclease coding element which kills Bacillus subtilis. Anti MazF element produces an mRNA which is reverse complemantary to mRNA produced by MazF. Thus, Anti Mazf mRNA binds to MazF mRNA and inhibit its activity for coding MazF protein. With pHyperspank promoter, the production of Anti MazF will be depend on IPTG presence in the medium. If there is IPTG in medium, it will inactivate LacI which inhibit pHyperspank promoter. Thus, Anti MazF will be produced. On the other hand, if there is no IPTG in medium, LacI will inhibit pHyperspank and Anti MazF mRNA cannot be produced. As a result MazF protein will be produced, and kills the bacteria. false false _1511_ 4206 12727 9 In stock false Anti MazF is designed as a complemantary sequence to the last 4 bases of the RBS sequence, 6 bases to the intermediate region and to the first 40 bases of MazF coding sequence, tottally 50 bases. false Alişan Kayab??len component2357085 1 BBa_K1197000 component2357084 1 BBa_K606040 annotation2357084 1 BBa_K606040 range2357084 1 1 92 annotation2357085 1 BBa_K1197000 range2357085 1 101 150 BBa_K1197000 1 BBa_K1197000 Anti MazF - Antisense RNA to inhibit MazF activity in B.subtilis 2013-09-19T11:00:00Z 2015-06-08T11:15:20Z It is synthesized as a reverse complementary sequence to MazF (K302033) Anti MazF is an antisense RNA producing sequence which is complemantary to MazF (K302033). MazF is a non-specific ribonuclease coding element which kills Bacillus subtilis. Anti MazF element produces an mRNA which is reverse complemantary to mRNA produced by MazF. Thus, Anti Mazf mRNA binds to MazF mRNA and inhibit its activity for coding MazF protein. false false _1511_ 4206 12727 9 In stock false This part is designed as a complemantary sequence to the last 4 bases of the RBS sequence, 6 bases to the intermediate region and to the first 40 bases of MazF coding sequence, tottally 50 bases. false Alişan Kayab??len BBa_K1197000_sequence 1 aaatcagatcgcccatatcgggtacgtatcggcttaccatctagtattca BBa_K1197002_sequence 1 aaatgtgagcactcacaattcattttgcaaaagttgttgactttatctacaaggtgtggcataatgtgtgtaattgtgagcggataacaatttactagagaaatcagatcgcccatatcgggtacgtatcggcttaccatctagtattca BBa_K606040_sequence 1 aaatgtgagcactcacaattcattttgcaaaagttgttgactttatctacaaggtgtggcataatgtgtgtaattgtgagcggataacaatt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z