BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K1197003 1 BBa_K1197003 AntiMazF + Double Terminator 2013-09-19T11:00:00Z 2015-06-08T11:16:06Z It is synthesized as a reverse complementary sequence to MazF (K302033) Anti MazF is an antisense RNA producing sequence which is complemantary to MazF (K302033). MazF is a non-specific ribonuclease coding element which kills Bacillus subtilis. Anti MazF element produces an mRNA which is reverse complemantary to mRNA produced by MazF. Thus, Anti Mazf mRNA binds to MazF mRNA and inhibit its activity for coding MazF protein. This part can be used with any promoter according to regulation mechanism. false false _1511_ 4206 12727 9 In stock false Anti MazF is designed as a complemantary sequence to the last 4 bases of the RBS sequence, 6 bases to the intermediate region and to the first 40 bases of MazF coding sequence, tottally 50 bases. false Ali&#351;an Kayab??len component2357095 1 BBa_B0015 component2357088 1 BBa_K1197000 annotation2357095 1 BBa_B0015 range2357095 1 59 187 annotation2357088 1 BBa_K1197000 range2357088 1 1 50 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_K1197000 1 BBa_K1197000 Anti MazF - Antisense RNA to inhibit MazF activity in B.subtilis 2013-09-19T11:00:00Z 2015-06-08T11:15:20Z It is synthesized as a reverse complementary sequence to MazF (K302033) Anti MazF is an antisense RNA producing sequence which is complemantary to MazF (K302033). MazF is a non-specific ribonuclease coding element which kills Bacillus subtilis. Anti MazF element produces an mRNA which is reverse complemantary to mRNA produced by MazF. Thus, Anti Mazf mRNA binds to MazF mRNA and inhibit its activity for coding MazF protein. false false _1511_ 4206 12727 9 In stock false This part is designed as a complemantary sequence to the last 4 bases of the RBS sequence, 6 bases to the intermediate region and to the first 40 bases of MazF coding sequence, tottally 50 bases. false Ali&#351;an Kayab??len BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1197000_sequence 1 aaatcagatcgcccatatcgggtacgtatcggcttaccatctagtattca BBa_K1197003_sequence 1 aaatcagatcgcccatatcgggtacgtatcggcttaccatctagtattcatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z