BBa_K1202004 1 BBa_K1202004 TorA signal peptide 2013-09-26T11:00:00Z 2015-05-08T01:09:40Z E.Coli Signal peptide, directs the proteins to the secration pathway. false false _1516_ 0 17058 9 Not in stock false Due to the rare codon analysis, codon optimization is performed for this part. Codons are optimized for E.coli false Muhammed Taha Akcay annotation2368994 1 TorA range2368994 1 1 126 BBa_K1202004_sequence 1 atgaataataatgatctgtttcaggcaagccgtcgtcgttttctggcacagctgggtggtctgaccgttgcaggtatgctgggtccgagcctgctgaccccgcgtcgtgcaaccgccgcacaggca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z