BBa_K1202006 1 BBa_K1202006 TAT(Trans-Activator of Transcription) protein 2013-09-26T11:00:00Z 2015-05-08T01:09:40Z Human Immunodefiency Virus-1(HIV-1) Directs the extracelluar proteins innto the cells. false false _1516_ 0 17058 9 Not in stock true Due to the rare codon analysis, codon optimization is performed for this part. Codons are optimized for E.coli false Muhammed Taha Akcay annotation2369034 1 TAT range2369034 1 1 33 BBa_K1202006_sequence 1 tatggtcgtaaaaaacgtcgtcagcgtcgtcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z