BBa_K1202009 1 BBa_K1202009 MPG Signal Peptide 2013-10-03T11:00:00Z 2015-05-08T01:09:40Z This part is a derivative of HIV and SV40. We found the sequence through our research of literature. Afterwards, GeneScript synthesized our gene. MPG is an signal peptide that directs the attached proteins into the eukaryotic cells. The proteins conduct this kind of activity called "cell penetrating peptides" (CPP). In our project, we want to use this protein to direct our cancer killing protein "apoptin" into the colon cancer cells, efficiently. false false _1516_ 0 11157 9 Not in stock true This part must be attached to C-terminus of the desired protein. We also added an additional 15 aa lenght linker domain between MPG and that protein. false Furkan Bestepe annotation2369077 1 MPG range2369077 1 1 72 BBa_K1202009_sequence 1 ggtgcactgtttctgggttggctgggtgcagccggtagcaccatgggtgcaccgaaaaaaaaacgtaaagtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z