BBa_K1202100 1 BBa_K1202100 Nanofactory Binding Zone (C215) 2013-09-23T11:00:00Z 2015-05-08T01:09:40Z This binding region belongs to anti-EpCAM antibody of human body. It is synthesized by GeneScript as the sequence we gave them. This part binds the EpCAM (Epithelial Cell Adhesion Molecule) antigen with great affinity. It is the binding region of our nanofactory part which consists of this region and additional enzyme region. false false _1516_ 0 17366 9 It's complicated true Due to the rare codon analysis, codon optimization is performed for this part. Codons are optimized for E.coli. Additionally, a linker peptide coding region is added for the maximum correctness for our experiments. Lastly, a his tag coding region is added for the purification purposes. false safa tapan annotation2369146 1 linker range2369146 1 69 113 annotation2369143 1 RBS range2369143 1 36 47 annotation2369144 1 Start Codon range2369144 1 48 50 annotation2369142 1 J23100 range2369142 1 1 35 annotation2369148 1 Stop Codon range2369148 1 477 482 annotation2369145 1 His tag range2369145 1 51 68 annotation2369147 1 C215 range2369147 1 114 476 BBa_K1202100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagcaaagaggagaaaatgcatcaccatcatcaccatggtggtggtggcagcggtggcggtggtagtggcggtggcggtagccaggttaaattacagcagagcggtgcagagctggttcgtccgggtgcaagcgttaaactgagctgtaaagcaagcggttatacctttaccaattattggattaattgggttaaacagcgtccgggtcagggcctggaatggattggtaatatttatccgagctatatttataccaattataatcaggagtttaaagataaagttaccctgaccgttgatgaaagcagcagcaccgcatatatgcagctgagcagcccgaccagcgaagatagcgcagtttattattgtacccgtagcccgtatggttatgatgaatatggcctggattattggggtcagggtaccaccgttaccgttagcagctaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z