BBa_K1202105 1 BBa_K1202105 TAT-Apoptin: Cancer killing peptide 2013-09-23T11:00:00Z 2015-05-08T01:09:40Z Tat: This part was prepared from Human Immunodefiency Virus-1(HIV-1) Apoptin: This part was prepared from Chicken Anemia Virus(CAV) This complex has two part. Tat : Tat protein putting in this complex to the cancer cell through dissolving cell membrane. Apoptin : Apoptin is forcing cancer cells to apoptosis when apoptin enter into cell. false false _1516_ 0 17058 9 It's complicated true Due to the rare codon analysis, codon optimization is performed for this part. Codons are optimized for E.coli. false Muhammed Taha Akcay annotation2369179 1 Stop Codon range2369179 1 510 515 annotation2369176 1 TAT range2369176 1 69 101 annotation2369174 1 His Tag range2369174 1 51 68 annotation2369175 1 Start Codon range2369175 1 48 50 annotation2369177 1 Linker range2369177 1 102 146 annotation2369173 1 J23100 range2369173 1 1 35 annotation2369172 1 RBS range2369172 1 36 47 annotation2369178 1 Apoptin range2369178 1 147 509 BBa_K1202105_sequence 1 ttgacggctagctcagtcctaggtacagtgctagcaaagaggagaaaatgcatcaccatcatcaccattatggtcgtaaaaaacgtcgtcagcgtcgtcgcggtggtggtggcagcggtggcggtggtagtggcggtggcggtagcatgaatgcattacaggaagataccccgccgggtccgagcaccgtttttcgtccgccgaccagcagccgtccgctggaaaccccgcattgtcgtgaaattcgtattggtattgcaggtattaccattaccctgagcctgtgtggttgtgcaaatgcacgtgcaccgaccctgcgtagcgcaaccgccgataatagcgaaagcaccggttttaaaaatgttccggatctgcgtaccgatcagccgaaaccgccgagcaaaaaacgtagctgtgatccgagcgaatatcgtgttagcgaactgaaagaaagcctgattaccaccaccccgagccgtccgcgtaccgcaaaacgtcgtatccgtctgtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z