BBa_K1202111 1 BBa_K1202111 MPG-Apoptin: Cancer killing peptide 2013-09-23T11:00:00Z 2015-05-08T01:09:40Z apoptin wss prepare from chicken anemia virus(CAV) this part has two component. Apoptin: forcing cancer cell to apoptosis ,Mpg:signal peptide false false _1516_ 0 17366 9 It's complicated true Due to the rare codon analysis, codon optimization is performed for this part. Codons are optimized for E.coli. Additionally, a linker peptide coding region is added for the maximum correctness for our experiments. Lastly, a his tag coding region is added for the purification purposes. false safa tapan annotation2369221 1 RBS range2369221 1 36 47 annotation2369225 1 MPG range2369225 1 69 140 annotation2369224 1 J23100 range2369224 1 1 35 annotation2369228 1 Stop Codon range2369228 1 549 554 annotation2369226 1 Linker range2369226 1 141 185 annotation2369223 1 His Tag range2369223 1 51 68 annotation2369222 1 Start Codon range2369222 1 48 50 annotation2369227 1 Apoptin range2369227 1 186 548 BBa_K1202111_sequence 1 ttgacggctagctcagtcctaggtacagtgctagcaaagaggagaaaatgcatcaccatcatcaccatggtgcactgtttctgggttggctgggtgcagccggtagcaccatgggtgcaccgaaaaaaaaacgtaaagttggtggtggtggcagcggtggcggtggtagtggcggtggcggtagcatgaatgcattacaggaagataccccgccgggtccgagcaccgtttttcgtccgccgaccagcagccgtccgctggaaaccccgcattgtcgtgaaattcgtattggtattgcaggtattaccattaccctgagcctgtgtggttgtgcaaatgcacgtgcaccgaccctgcgtagcgcaaccgccgataatagcgaaagcaccggttttaaaaatgttccggatctgcgtaccgatcagccgaaaccgccgagcaaaaaacgtagctgtgatccgagcgaatatcgtgttagcgaactgaaagaaagcctgattaccaccaccccgagccgtccgcgtaccgcaaaacgtcgtatccgtctgtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z