BBa_K1204013 1 BBa_K1204013 TEF1pr-BS1x-16A 2013-09-15T11:00:00Z 2015-05-08T01:09:40Z The binding site was synthetically designed using the binding rules for iTALs and gRNA/dCas9 complex and ordered as a gene block from IDT. The TEF1 promoter is a strong constitutive promoter in yeast that we got from another plasmid in the lab. This is a strong constitutive promoter in yeast with a binding site downstream. The binding site is designed to be directly targeted by our iTAL 16A or gRNA 16A. When the binding site is occupied by an iTAL or gRNA/dCas9 complex, the expression of the YFP reporter should be knocked down. false false _1518_ 0 17071 9 It's complicated false We had to consider the manner in which iTALs and gRNA/dCas9 complex bind in designing our sequence. false Matthew Baron BBa_K1204013_sequence 1 cgcgccctcatagcttcaaaatgtttctactccttttttactcttccagattttctcggactccgcgcatcgccgtaccacttcaaaacacccaagcacagcatactaaatttcccctctttcttcctctagggtgtcgttaattacccgtactaaaggtttggaaaagaaaaaagagaccgcctcgtttctttttcttcgtcgaaaaaggcaataaaaatttttatcacgtttctttttcttgaaaattttttttttgatttttttctctttcgatgacctcccattgatatttaagttaataaacggtcttcaatttctcaagtttcagtttcatttttcttgttctattacaactttttttacttcttgctcattagaaagaaagcatagcaatctaatctaagttttcttctagtagtaaaagtcccttctgtacagtgacgctggtagtcgaaatcggatagctagaccgaaaagtagctgttcaccatcacctgaacacccagtcagcgagcacgctagcaactgaaggcctctgtccagtatagtgcacta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z