BBa_K1212000 1 BBa_K1212000 Theophylline Riboswitch (Clone 8.1*) 2013-09-15T11:00:00Z 2015-05-08T01:09:41Z Nucleic Acids Res. 2009 January; 37(1): 184???192. Synthetic riboswitch screened from a library of randomized mutants created by cloning theophylline aptamers upstream of the RBS of a B-galactosidase reporter gene where the distance between the aptamer and the RBS was variable. Codes for an RNA secondary structure that, in the presence of theophylline, undergoes a conformational change that makes the previously sequestered ribosome binding site available for binding thus allowing for transcription of the downstream sequence. Nominal induction levels for theophylline are 0 to 10 mM. Achieves an 59 - fold activation ratio in 1 mM theophylline as reported by Gallivan and Lynch in 'A flow cytometry based screen for synthetic riboswitches.' Nucleic Acids Res. 2009 January; 37(1): 184???192. false false _1526_ 0 18052 9 Not in stock false None. false Aura Ferreiro annotation2363692 1 Theophylline aptamer range2363692 1 1 38 annotation2363690 1 RBS/Shine Dalgarno range2363690 1 46 49 BBa_K1212000_sequence 1 ggtgataccagcatcgtcttgatgcccttggcagcaccccgctgcaggacaacaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z