BBa_K1212001 1 BBa_K1212001 Theophylline Riboswitch (Clone E) 2013-09-15T11:00:00Z 2015-05-08T01:09:41Z Appl. Environ. Microbiol. December 2010 vol. 76 no. 23 7881-7884. Synthetic riboswitch generated through rational design and in vivo screening. Encodes a RNA secondary structure that in the presence of theophylline undergoes a conformational change that makes available the previously sequestered RBS, thus allowing transcription of the downstream sequence. Achieves a 60-fold activation ratio in 2mM theophylline as reported by Topp et al. in: 'Synthetic Riboswitches That Induce Gene Expression in Diverse Bacterial Species.' Appl. Environ. Microbiol. December 2010 vol. 76 no. 23 7881-7884 false false _1526_ 0 18052 9 Not in stock false None. false Aura Ferreiro annotation2363694 1 Theophylline aptamer range2363694 1 1 38 annotation2363695 1 RBS range2363695 1 44 51 BBa_K1212001_sequence 1 ggtgataccagcatcgtcttgatgcccttggcagcaccctgctaaggaggtaacaacaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z