BBa_K1214006 1 BBa_K1214006 pScr 2013-09-15T11:00:00Z 2015-05-08T01:09:41Z Isolated from genome of S. mutans Sucrose operon promoter. Regulated by sucrose operon repressor ScrR. false false _1528_ 0 13834 9 It's complicated false no considerations false Alec Spinhirne BBa_K1214006_sequence 1 agattcttttttgcaacaaaagattgatttttagaaagaaaacgtttactatattagtatgtagataaactattattaggagtagataaacg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z