BBa_K1218001 1 BBa_K1218001 This is the sacY promoter. 2013-08-18T11:00:00Z 2015-05-08T01:09:42Z From Bacillus subtilis. This part is the sacY promoter, isolated from the genome of Bacillus subtilis. SacY is a regulator of sucrose induction. false false _1532_ 0 18104 9 In stock false Used oligos ordered from ElimBio. false Ravali Reddy BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1218020 1 BBa_K1218020 sacY promoter + RBS 2013-09-03T11:00:00Z 2015-05-08T01:09:42Z Constructed sacY from oligose from Elim. RBS from registry. This is a compound part of the promoter for sacY (a Bacillus subtilis sucrose inducer) (BBa_K1218001) and a ribosome binding site (BBa_B0064). false false _1532_ 0 17531 9 It's complicated false None false Evie Pless component2334950 1 BBa_K1218001 component2334952 1 BBa_B0034 annotation2334952 1 BBa_B0034 range2334952 1 52 63 annotation2334950 1 BBa_K1218001 range2334950 1 1 43 BBa_B0034_sequence 1 aaagaggagaaa BBa_K1218001_sequence 1 tatggcgggattgtgactgggcaggcaggcaagacccaatgat BBa_K1218020_sequence 1 tatggcgggattgtgactgggcaggcaggcaagacccaatgattactagagaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z