BBa_K1218022 1 BBa_K1218022 50bp24CC Hairpin Nanowire 2013-09-08T11:00:00Z 2015-05-08T01:09:42Z Synthetic: generated by DNA 2.0. Overview: The 50bp24CC Hairpin Nanowire is a dual-function brick for producing a silver-chelating/intercalating hairpin nanowire. Silver is taken up by cytosine-cytosine mismatches in the hairpin. Rather than the canonical hydrogen bonds between a purine and pyrimidine, this system uses Ag+ ions to bridge the gap between the N3 sites on opposing pyrimidines. This brick is designed to function in vitro as an extra-cellular BioBrick. Specs: ??? DNA hairpin is 100 bases, thus 50bp in length ??? RNA hairpin is 113 bases, with 54bp forming a hairpin ??? 24 CC mismatches are built into the system (48% and 44% mismatched, respectively) DNA hairpin excision: The brick is packaged with premade primer sequences for PCR. These primers are: F-CAACCATACGACACGCCTC (Tm 58.6⁰C) and R-ACCTCACCGACTCAGCC (Tm 58.2⁰C). Once amplified, the double stranded product can be removed using Pme1 blunt-end restriction sites on the ends of the hairpin. Pme1 has an 8-base restriction site, and the 4 leftover bases are a part of the 100 bases in the hairpin. Removal of the anti-sense strand can be done by adding a high concentration of an interfering probe and gel extracting the lighter band. The mismatched hairpin can now be annealed (below). In a nutshell, to produce the DNA hairpin ??? Amplify target region using pre-designed primers ??? Digest with Pme1 ??? Target anti-sense with high concentration probe DNA ??? Gel extract desired fragment ??? Anneal product RNA hairpin excision: The brick includes a T7 promoter. To produce the RNA product, begin in the same manner by amplifying the target region using the following primers: F-CAACCATACGACACGCCTC (Tm 58.6⁰C) and R- ACCTCACCGACTCAGCC (Tm 58.2⁰C). From this point, any RNA product will include the forward primer, so we further digest with EcoRV to remove the primers from the template. At this point, a T7 polymerase can be used to produce a large amount of the mRNA product (We suggest using the MEGAshortscript T7 Kit from Life Technologies). The hairpin can now be annealed (below). In a nutshell, to produce the RNA hairpin: ??? Amplify target sequence using pre-designed primers ??? Digest with EcoRV ??? Add T7 RNA polymerase ??? Anneal product Annealing DNA: To ensure optimal silver uptake, AgNO3 is added at a 1:1 molarity with CC mismatches. Thus there should be a 24:1 molar ratio between AgNO3 and the DNA/RNA product. The optimal buffer has been experimentally determined to be 10mM MOPS with 100mM NaNO3. In circumstances requiring other buffers (MS, NMR), 10mM ammonium acetate and 10mM phosphate buffer have been substituted for MOPS. Avoid any chelating buffers such as TAE, as this will inhibit silver uptake by the nucleic acid. Add silver and buffer to your sample, and heat at 90⁰C for 2 minutes, then let cool slowly to room temperature over the course of an hour. For optimal annealing, let cool at 4⁰C for an additional hour prior to experimentation. Store at -20⁰C for best results. Experimental notes: Annealed product gels best in 4% agarose gel made in 10mM MOPS (no NaNO3), or polyacrylamide gel under the same conditions. If using 10bp ladder, run at 4⁰C. Intercalated silver can withstand isopropanol and ethanol precipitation. false false _1532_ 0 17562 9 In stock false The design of this piece required a dual-function: DNA as well as RNA production. As such, the use of differing restriction sites, pre-designed primers and promoters were incorporated. false Simon Vecchioni annotation2337152 1 F_primer range2337152 1 1 19 annotation2337153 1 EcoRV site range2337153 1 20 25 annotation2337158 1 Pme1 site range2337158 1 128 135 annotation2337156 1 EcoRV site range2337156 1 156 161 annotation2337159 1 RNA hairpin product range2337159 1 23 135 annotation2337157 1 T7 promoter range2337157 1 136 155 annotation2337160 1 DNA hairpin product range2337160 1 32 131 annotation2337154 1 Pme1 site range2337154 1 28 35 annotation2337155 1 R_primer range2337155 1 162 178 BBa_K1218022_sequence 1 caaccatacgacacgcctcgatatcaagtttaaacactactccctcctacccaccacacaactcatcactcaacacctcacctcacctcttcactcatcacttctctcctccctaccacccactactgtttaaacccctatagtgagtcgtattagatatcggctgagtcggtgaggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z