BBa_K1218026 1 Star 32bp10CC Duplex Nanowire 2013-09-16T11:00:00Z 2015-05-08T01:09:42Z This part is entirely synthetic. Overview: The 30bp10CC Duplex Nanowire is a produces a silver-chelating/intercalating hairpin nanowire. Silver is taken up by cytosine-cytosine mismatches in the hairpin. Rather than the canonical hydrogen bonds between a purine and pyrimidine, this system uses Ag+ ions to bridge the gap between the N3 sites on opposing pyrimidines. This brick is designed to function in vitro as an extra-cellular BioBrick. Specs: ??? DNA duplex 32bp in length ??? 10 mismatches, bundled in the center in a 2-1-2 pattern (CCACC???) ??? Will only anneal in the presence of Ag+ Duplex Sequence: 5??? AAA CAT TTA CC A CC T CC T CC A CC T TAT AGT TT 3??? ||| ||| ||| ?????? | ?????? | ?????? | ?????? | ?????? | ||| ||| || 3??? TTG TTA AAT CC T CC A CC A CC T CC A ATA TCA AA 5??? DNA duplex excision: The brick is packaged with premade primer sequences for PCR. These primers are: F-CCAAGCACGCCCACCT (Tm 59.5⁰C) and R-TGGTAGGTGGCGGTGC (Tm 58.8⁰C). Once amplified, the mismatch-complimentary sequences can be removed using Pme1 blunt-end restriction sites. The two strands abut one another, the first and last four bases of the sequence constituting half of the 8-bp Pme1 cut site. There are three Pme1 sites, one at the beginning of the region, one between the two strands, and one at the end of the region. Removal of the anti-sense strand can be done by adding a high concentration of an interfering probe and gel extracting the lighter band. The duplex can now be annealed. Annealing DNA: To ensure optimal silver uptake, AgNO3 is added at a 1:1 molarity with CC mismatches. Thus there should be a 10:1 molar ratio between AgNO3 and the DNA product. The optimal buffer has been experimentally determined to be 10mM MOPS with 100mM NaNO3. In circumstances requiring other buffers (MS, NMR), 10mM ammonium acetate and 10mM phosphate buffer have been substituted for MOPS. Avoid any chelating buffers such as TAE, as this will inhibit silver uptake by the DNA. Add silver and buffer to the sample, and heat at 90⁰C for 2 minutes, then let cool slowly to room temperature over the course of an hour. For optimal annealing, let cool at 4⁰C for an additional hour prior to experimentation. Store at -20⁰C for best results. In sum, to produce the DNA duplex ??? Amplify target region using pre-designed primers ??? Digest with Pme1 ??? Target anti-sense with high concentration probe DNA ??? Gel extract desired fragment ??? Anneal product Experimental notes: Annealed product gels best in 4% agarose gel made in 10mM MOPS (no NaNO3), or 10% polyacrylamide gel under the same conditions. If using 10bp ladder, run at 4⁰C. Intercalated silver can withstand isopropanol and ethanol precipitation. false false _1532_ 0 17562 9 In stock false The part must produce a DNA duplex from a DNA sequence, which requires restriction digest and cleanup. false Simon Vecchioni annotation2351047 1 Star strand 2 (mismatch compliment) range2351047 1 73 104 annotation2351021 1 F_primer range2351021 1 1 16 annotation2351026 1 Pme1 site range2351026 1 69 76 annotation2351027 1 Pme1 site range2351027 1 101 108 annotation2351028 1 R_primer range2351028 1 109 124 annotation2351046 1 Star strand 1 (template) range2351046 1 41 72 annotation2351024 1 Pme1 site range2351024 1 37 44 BBa_K1218026_sequence 1 ccaagcacgcccaccttaatacgactcactataggggtttaaacatttaccacctcctccaccttatagtttaaactataacctccaccacctcctaaatgtttaaacgcaccgccacctacca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z