BBa_I719005 1 pT7 T7 Promoter 2007-10-23T11:00:00Z 2015-08-31T04:07:53Z --- Released HQ 2013 Just a T7 Promoter false false _128_ 0 2097 9 In stock true None true Imperial 2007 BBa_K731721 1 BBa_K731721 T7 terminator 2012-08-14T11:00:00Z 2015-05-08T01:13:06Z We amplified it directly from pET21b. Released HQ 2013 This is a short terminator by T7phage that we tested with our new teminators' characterization system. false false _977_ 0 12063 9 In stock true This is a standard sequence, very used in many constructs. As i don't have any design considerations i can say that generally to make screening gels of such short segments is preferable to use TBE1X instead of TAE1X. false Giacomo Giacomelli, Anna Depetris annotation2180632 1 T7 terminator range2180632 1 1 48 BBa_K1222004 1 BBa_K1222004 pCam(T7 promoter+lac operator+CamR antisense 2+T7 terminator) 2013-09-22T11:00:00Z 2015-05-08T01:09:43Z This is composed of previous part(BBa_I719005,BBa_K731721)and part we constructed(BBa_K1222998,BBa_K1222989,BBa_K1222988). T7 promoter + lac operator + camR antisense 2 + T7 terminator. This part is IPTG inducible for regulating generation of CamR antisense.We design three CamR antisense for inhibit CamR.(BBa_K1222998,BBa_K1222989,BBa_K1222988)This part shows CamR antisense 2. false false _1536_ 0 18248 9 Not in stock false no. false Tingling Ke component2359660 1 BBa_K1222983 component2359662 1 BBa_K731721 component2359659 1 BBa_I719005 annotation2359660 1 BBa_K1222983 range2359660 1 32 96 annotation2359662 1 BBa_K731721 range2359662 1 105 152 annotation2359659 1 BBa_I719005 range2359659 1 1 23 BBa_K1222983 1 BBa_K1222983 Lac operator+CamR antisense 2/pSB1C3 2013-08-25T11:00:00Z 2015-05-08T01:09:43Z We designed and made it by artificial synthesis. A short sequence that inhibits chloramphenicol antibiotic gene is regulated by lac operator . false false _1536_ 0 18249 9 It's complicated false NO false Yu-Chun Huang BBa_I719005_sequence 1 taatacgactcactatagggaga BBa_K1222004_sequence 1 taatacgactcactatagggagatactagagggaattgtgagcggataacaattccaattacgccccgccctgccactcatcgcagtactgttgtatactagagctagcataaccccttggggcctctaaacgggtcttgaggggttttttg BBa_K731721_sequence 1 ctagcataaccccttggggcctctaaacgggtcttgaggggttttttg BBa_K1222983_sequence 1 ggaattgtgagcggataacaattccaattacgccccgccctgccactcatcgcagtactgttgta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z