BBa_K1222988 1 BBa_K1222988 GFP antisense 3/pSB1C3 2013-08-25T11:00:00Z 2015-05-08T01:09:43Z We designed and made it by artificial synthesis. A short sequence inhibits middle section of GFP gene. false false _1536_ 0 18249 9 It's complicated false no false Yu-Chun Huang BBa_K1222988_sequence 1 tcgattctattaacaagggtatcaccttcaaacttgactt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z