BBa_K1223005 1 BBa_K1223005 cI translational unit 2013-09-06T11:00:00Z 2015-05-08T01:09:43Z genebank, iGEM parts registry Lambda cI translational unit with BBa_K345000 as promoter false false _1537_ 0 18143 9 It's complicated false regulatory device false Orr Schlesinger component2358783 1 BBa_B0034 component2358785 1 BBa_K1223004 component2358781 1 BBa_K354000 annotation2358785 1 BBa_K1223004 range2358785 1 132 845 annotation2358781 1 BBa_K354000 range2358781 1 1 105 annotation2358783 1 BBa_B0034 range2358783 1 114 125 BBa_K1223004 1 BBa_K1223004 Lambda cI CDS 2013-09-06T11:00:00Z 2015-05-08T01:09:43Z genbank . false false _1537_ 0 18143 9 Not in stock false cI CDS without LVA false Orr Schlesinger annotation2335260 1 Lambda cI range2335260 1 1 714 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K354000 1 BBa_K354000 Lac/Ara-1 IPTG Inducible Promoter 2010-10-18T11:00:00Z 2015-05-08T01:12:11Z The promoter was synthesised via primer extension. Derived from the L-arabinose and Lactose operons, this synthetic promoter remains in the 'off' state due to the repression of the AraC protein. AraC is constitutively expressed in bacteria possessing the arabinose operon and as such is present in E. coli. When exogenous arabinose and/or IPTG is added, the AraC protein is freed from the promoter thus allowing RNA polymerase to bind and initiate transcription. Hence, addition of arabinose or IPTG will switch the promoter into the 'on' state. false false _481_ 0 6469 9 It's complicated false The affiliation between AraC and its binding sequence had to be ensured so as to prevent basal expression and false triggering of the promoter. false Gregory Meyer annotation2090002 1 AraC Binding Site range2090002 1 2 37 annotation2090001 1 -33 Hexamer range2090001 1 38 43 annotation2090004 1 -10 Hexamer range2090004 1 58 66 annotation2090003 1 Symmetrical Synthetic Operator range2090003 1 44 57 annotation2090005 1 Lac Operon operator Sequence range2090005 1 72 102 BBa_B0034_sequence 1 aaagaggagaaa BBa_K1223004_sequence 1 atgggcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctgagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggctaa BBa_K1223005_sequence 1 gcatagcatttttatccataagattagcggatctaacctttacaattgtgagcgctcacaattatgatagattcaattgtgagcggataacaatttcacacagattactagagaaagaggagaaatactagatgggcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctgagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggctaa BBa_K354000_sequence 1 gcatagcatttttatccataagattagcggatctaacctttacaattgtgagcgctcacaattatgatagattcaattgtgagcggataacaatttcacacagat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z