BBa_K1223006 1 BBa_K1223006 His-Tag 2013-09-06T11:00:00Z 2015-05-08T01:09:43Z synthetic c-term His tag for purification and identification of protein of interest. false false _1537_ 0 18143 9 It's complicated false purification and identification of protein of interest. false Orr Schlesinger annotation2335271 1 stop codon range2335271 1 25 27 annotation2335270 1 6X His-Tag range2335270 1 1 24 BBa_K1223006_sequence 1 gtgcaccaccaccaccatcacgtgtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z