BBa_K1223014 1 BBa_K1223014 tRNA-Pyl (pylT) gene from Methanosarcina barkeri str. Fusaro 2013-10-02T11:00:00Z 2015-05-08T01:09:43Z Methanosarcina barkeri str. Fusaro genomic sequence. this is the DNA coding sequence for the tRNA of pyrrolysine from the Archaea Methanosarcina barkeri str. Fusaro. this tRNA is a part of the machinery that is used to incorporate pyrolysine into proteins in E.coli. the tRNA synthetase that charges the tRNA with pyrrolysine can be found in biobrick BBa_k1223013. the tRNA has the anticodon CUA - which means that the sense codon needed to incorporate pyrrolysine is TAG - the amber stop codon. false false _1537_ 0 18143 9 It's complicated true this is a part of the pyrrolysine incorporation machinery. false Orr Schlesinger annotation2367517 1 pyrrolysine tRNA CDS range2367517 1 1 72 annotation2367519 1 CUA anticodon range2367519 1 31 33 BBa_K1223014_sequence 1 gggaacctgatcatgtagatcgaatggactctaaatccgttcagccgggttagattcccggggtttccgcca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z