BBa_K1225000 1 BBa_K1225000 Promoter with flanking BpiI sites for GGC. 2013-09-15T11:00:00Z 2015-05-08T01:09:43Z The Ptrc promoter comes from E. coli. This is a medium-strength Escherichia coli Ptrc* promoter. The asterisk denotes the lack of an operator downstream of the transcription start site, -35 to +1 of the promoter. The promoter's sequence comes from "Precise and reliable gene expression via standard transcription and translation initiation elements" by Vivek K. Mutalik and colleagues. Two inward pointing BpiI (BbsI) sites were added between the original promoter sequence and the BioBrick prefix and suffix to allow seamless assembly into the 2013 Purdue iGEM team's Bicistronic Design (BCD) Expression Operating Units, modified versions of BCDs 7, 18, 22 and 23 created by Mutalik et al. in the aforementioned work. false false _1539_ 0 12685 9 It's complicated false The BpiI binding sites lie between the promoter and BioBrick cut sites, so the part can be handled at HQ but can also be seamlessly cloned into our BCD EOUs with Golden Gate assembly. false James Nolan annotation2365339 1 BpiI range2365339 1 55 60 annotation2348420 1 BpiI range2348420 1 1 6 annotation2365340 1 Ptrc* range2365340 1 13 48 BBa_K1225000_sequence 1 gaagaccgtaacttgacaattaatcatccggctcgtataatgtgtggagggcatgtcttc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z