BBa_K1228000 1 BBa_K1228000 Human Lysozyme coding sequencing 2013-09-01T11:00:00Z 2015-05-08T01:09:43Z it was synthesized in Wuhan Bio-Broad Co.Ltd Human lysozyme (hLZ), the actual protein in breast milk,exhibits microbicidal activity to various degrees against several bacterial strains.The HLH peptide and its N-terminal helix (H1) were significantly the most potent bactericidal to Gram-positive and Gram-negative bacteria.Evidence shows that HLH peptide and its N-terminal helix (H1) kill bacteria by crossing the outer membrane of Gram-negative bacteria via self-promoted uptake and are able to dissipate the membrane potential-dependent respiration of Gram-positive bacteria. false false _1542_ 0 17353 9 In stock false Codon optimization has been done,so the protein will be expressed normally in Ecolic. false Le Xiong BBa_K1228000_sequence 1 aaagcgtttgaacgctgcgaactggcgcgcaccctgaaacgcctgggcatggatggctatcgtggtattagcctggcgaactggatgtgcctggcgaaatgggaaagcggttat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z