BBa_K1228004 1 BBa_K1228004 A fragment of loctoferrin 2013-09-08T11:00:00Z 2015-05-08T01:09:43Z 25aa comes from Lf,which was hydrolysed by protease. Lf (loctoferrin) is located in many key body fluids , e.g., milk, tears, saliva and other secretions, and in white blood cells ,it has become clear that it is an important part of mammalian defence mechanisms, with a wide range of protective functions.25 amino acid residues is from Lf but has a strong bactericidal, bacteriostatic ability, and the antimicrobial activity than natural LF. false false _1542_ 0 17767 9 In stock false It doesn't contain initiator codon false Zhang SW BBa_K1228004_sequence 1 tttaaatgccgtcgctggcagtggcgcatgaagaaactgggcgccccgagcattacctgcgtgcgtcgcgccttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z