BBa_K1228006 1 BBa_K1228006 25aa with T1 terminator and Constitutive promoter veg 2013-09-08T11:00:00Z 2015-05-08T01:09:43Z 25aa comes from Lf,which was hydrolysed by protease. We synthesis it by Wu Han Bio-broad Co.Ltd Lf (loctoferrin) is located in many key body fluids , e.g., milk, tears, saliva and other secretions, and in white blood cells ,it has become clear that it is an important part of mammalian defence mechanisms, with a wide range of protective functions.25 amino acid residues is from Lf but has a strong bactericidal, bacteriostatic ability, and the antimicrobial activity than natural LF.We add T1 terminator and Constitutive promoter veg on the 25aa to make it can work regularly. false false _1542_ 0 17767 9 In stock false 25aa doesn't contain initiator codon and terminator,so we add a Constitutive promoter veg and T1 terminator . false Zhang SW annotation2337061 1 rbs range2337061 1 106 117 annotation2337062 1 BBa_K143021 range2337062 1 106 117 annotation2337063 1 SacB Signal tag range2337063 1 124 219 annotation2337065 1 BBa_K1228004 range2337065 1 228 302 annotation2337064 1 BBa_K541501 range2337064 1 1 219 annotation2337057 1 BBa_K143012 range2337057 1 1 97 annotation2337060 1 Sigma A -10 range2337060 1 86 91 annotation2337058 1 BBa_K143053 range2337058 1 1 117 annotation2337059 1 Sigma A-35 range2337059 1 63 68 annotation2337067 1 BBa_K731722 range2337067 1 311 389 annotation2337066 1 B0010 range2337066 1 311 389 BBa_K1228006_sequence 1 gaattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgttactagagaaaggtggtgaatactagatgaacatcaaaaaatttgcaaaacaggcgacagttctgacatttacaacagcactgcttgcaggcggcgcaacacaagcatttgcaaaagaaacatactagagtttaaatgccgtcgctggcagtggcgcatgaagaaactgggcgccccgagcattacctgcgtgcgtcgcgccttttactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z