BBa_K1228009 1 BBa_K1228009 38aa and 25aa fusion peptide with T1 terminator and Constitutive promoter veg 2013-09-09T11:00:00Z 2015-05-08T01:09:43Z 25aa comes from Lf,which was hydrolysed by protease.38aa comes from Human Lysozyme. They were both synthesized in Wuhan Bio-Broad Co.Ltd Human lysozyme (hLZ), the actual protein in breast milk,exhibits microbicidal activity to various degrees against several bacterial strains.The HLH peptide and its N-terminal helix (H1) were significantly the most potent bactericidal to Gram-positive and Gram-negative bacteria.Evidence shows that HLH peptide and its N-terminal helix (H1) kill bacteria by crossing the outer membrane of Gram-negative bacteria via self-promoted uptake and are able to dissipate the membrane potential-dependent respiration of Gram-positive bacteria. Lf (loctoferrin) is located in many key body fluids , e.g., milk, tears, saliva and other secretions, and in white blood cells ,it has become clear that it is an important part of mammalian defence mechanisms, with a wide range of protective functions.25 amino acid residues is from Lf but has a strong bactericidal, bacteriostatic ability, and the antimicrobial activity than natural LF. false false _1542_ 0 17767 9 In stock false Codon optimization has been done,so the protein will be expressed normally in Ecoli. false Zhang SW annotation2337480 1 BBa_K541501 range2337480 1 1 219 annotation2337490 1 BBa_K731722 range2337490 1 433 511 annotation2337479 1 BBa_K143053 range2337479 1 1 117 annotation2337489 1 B0010 range2337489 1 433 511 annotation2337482 1 Sigma A -10 range2337482 1 86 91 annotation2337491 1 BBa_K1228005 range2337491 1 350 511 annotation2337484 1 BBa_K143021 range2337484 1 106 117 annotation2337478 1 BBa_K143012 range2337478 1 1 97 annotation2337483 1 rbs range2337483 1 106 117 annotation2337481 1 Sigma A-35 range2337481 1 63 68 annotation2337488 1 BBa_K1228004 range2337488 1 350 424 annotation2337487 1 BBa_K1228007 range2337487 1 1 341 annotation2337485 1 SacB Signal tag range2337485 1 124 219 annotation2337486 1 BBa_K1228000 range2337486 1 228 341 BBa_K1228009_sequence 1 gaattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgttactagagaaaggtggtgaatactagatgaacatcaaaaaatttgcaaaacaggcgacagttctgacatttacaacagcactgcttgcaggcggcgcaacacaagcatttgcaaaagaaacatactagaaagcgtttgaacgctgcgaactggcgcgcaccctgaaacgcctgggcatggatggctatcgtggtattagcctggcgaactggatgtgcctggcgaaatgggaaagcggttattactagagtttaaatgccgtcgctggcagtggcgcatgaagaaactgggcgccccgagcattacctgcgtgcgtcgcgccttttactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z