BBa_K1230005 1 BBa_K1230005 -- No description -- 2013-09-11T11:00:00Z 2015-05-08T01:09:44Z Designed de novo by Chou et al. (2008) GW-Q5 is a cationic alpha-helical peptide designed de novo using the natural peptide Magainin as a template, upon which variants that maintained major structural determinants like electric charge, hydrophobicity and angular momentum were designed. This peptide showed antimicrobial activity against Gram-positive and Gram-negative bacteria, and in particular it showed a Minimab Inhibitory Concentration 4 ??g/ml against Vibrio harveyi, 8 ??g/ml against V. parahemoliticu,s and 8??g/ml against Escherichia coli3. Reference H.-T. Chou et al. / International Journal of Antimicrobial Agents 32 (2008) 130???138 false false _1544_ 0 18579 9 It's complicated false Chou et al. synthesized GW-Q5 by solid-phase peptide synthesis, and thus they provide an Aminoacid sequence but no DNA sequence. Therefore we had to design a DNA sequence that had the codons corresponding to the given Peptide. false BBa_K1230005_sequence 1 ggcgcgaacgcgctgaagaagtacttcaccatcctgaagaagttcttcaaactggcgtggtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z