BBa_J32015 1 PelB PelB leader sequence; directs protein to E. coli periplasmic membrane 2006-08-24T11:00:00Z 2015-08-31T04:08:46Z Novagen Released HQ 2013 The pelB leader sequence is a sequence of amino acids which when attached to a protein, directs the protein to the periplasmic membrane of E. coli, where the sequence is removed by pelB peptidase. It is used to direct coat protein-antigen fusions to the cell surface. false true _50_ 0 495 50 In stock true . true Austen Heinz annotation1898182 1 PelB range1898182 1 1 66 BBa_K1230005 1 BBa_K1230005 -- No description -- 2013-09-11T11:00:00Z 2015-05-08T01:09:44Z Designed de novo by Chou et al. (2008) GW-Q5 is a cationic alpha-helical peptide designed de novo using the natural peptide Magainin as a template, upon which variants that maintained major structural determinants like electric charge, hydrophobicity and angular momentum were designed. This peptide showed antimicrobial activity against Gram-positive and Gram-negative bacteria, and in particular it showed a Minimab Inhibitory Concentration 4 ??g/ml against Vibrio harveyi, 8 ??g/ml against V. parahemoliticu,s and 8??g/ml against Escherichia coli3. Reference H.-T. Chou et al. / International Journal of Antimicrobial Agents 32 (2008) 130???138 false false _1544_ 0 18579 9 It's complicated false Chou et al. synthesized GW-Q5 by solid-phase peptide synthesis, and thus they provide an Aminoacid sequence but no DNA sequence. Therefore we had to design a DNA sequence that had the codons corresponding to the given Peptide. false BBa_K1230006 1 BBa_K1230006 -- No description -- 2013-09-11T11:00:00Z 2015-05-08T01:09:44Z PelBQ5 was obtained from biopart BBa_J32015. GW-Q5 was obtained de novo by Chou et al. (2008) H.-T. Chou et al. / International Journal of Antimicrobial Agents 32 (2008) 130???138 The present construction will allow the secretion of an antimicrobial peptide into de medium by the 5??? joining of the PelB leader sequence to the antimicrobial peptide GW-Q5. PelB is a 20 aminoacid N??? terminal sequence which directs the proteins for their exportation into the medium trough type II secretion, in which the protein goes to the periplasm before exportation via the Sec translocation machinery in the outer membrane GW-Q5 is a cationic alpha-helical peptide designed de novo using the natural peptide Magainin as a template, upon which variants that maintained major structural determinants like electric charge, hydrophobicity and angular momentum. false false _1544_ 0 18579 9 It's complicated false PelB and GwQ5 were fused by PCR making a Reverse primer which added to the 3' extreme of PelB the first 20 base pairs of GW-Q5. false component2339089 1 BBa_J32015 component2339090 1 BBa_K1230005 annotation2339090 1 BBa_K1230005 range2339090 1 75 137 annotation2339089 1 BBa_J32015 range2339089 1 1 66 BBa_J32015_sequence 1 atgaaatacctgctgccgaccgctgctgctggtctgctgctcctcgctgcccagccggcgatggcc BBa_K1230006_sequence 1 atgaaatacctgctgccgaccgctgctgctggtctgctgctcctcgctgcccagccggcgatggcctactagagggcgcgaacgcgctgaagaagtacttcaccatcctgaagaagttcttcaaactggcgtggtaa BBa_K1230005_sequence 1 ggcgcgaacgcgctgaagaagtacttcaccatcctgaagaagttcttcaaactggcgtggtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z