BBa_K1230001 1 LL-37 LL-37 antimicrobial peptide 2013-09-07T11:00:00Z 2016-02-01T12:49:22Z Synthesis from genscript The human peptide LL-37 is a cationic antimicrobial peptide with activity against Gram-negative and Gram-positive bacteria. It has been shown to protect against Helicobacter pylori infection and its related gastritis, besides of inhibiting the growth of other pathogenic bacteria in the gastrointestinal tract such as Salmonella typhimurium and Escherichia coli. false false _1544_ 4206 17080 9 It's complicated false Addition of initiation and stop codons. false Andr??s Ferri??o Iriarte annotation2335369 1 LL-37 range2335369 1 1 120 annotation2335370 1 Start range2335370 1 1 3 annotation2335371 1 Stop range2335371 1 114 120 BBa_K1230004 1 BBa_K1230004 MarA Generator 2013-09-07T11:00:00Z 2015-05-08T01:09:44Z 2013 DNA distribution and synthesis by genscript. The MarA protein acts as a transcriptional activator in E. coli. It allows the expression of the acrAB and tolC operons, which activate the AcrAB-TolC efflux pump, a mechanism that has been related with resistance to organic solvents, dyes, detergents, antibiotics such as chloramphenicol, tetracycline, novobiocin, erythromycin, fusidic acid and cloxacillin, as well as to cationic antimicrobial peptides, such as LL-37, HNP-2 and HBD-1. This composite part allows MarA expression in presence of IPTG, by using the LacI promoter and the RBS based on Elowitz repressilator (Part BBa_J04500) false false _1544_ 0 17080 9 It's complicated true We ligated part BBa_K875009 as a prefix and part BBa_E0840 as a suffix. false Andr??s Ferri??o Iriarte component2335446 1 BBa_J04500 component2335451 1 BBa_K1230000 annotation2335446 1 BBa_J04500 range2335446 1 1 220 annotation2335451 1 BBa_K1230000 range2335451 1 227 619 BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961224 1 -35 range1961224 1 137 142 annotation1961227 1 start range1961227 1 173 173 annotation1961225 1 -10 range1961225 1 161 166 BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_K1230016 1 BBa_K1230016 pLacI-rbs-MarA-rbs-GFP-double terminator-pLsrA-rbs-LL-37 2013-09-25T11:00:00Z 2015-05-08T01:09:44Z Genscript 2013 DNA distribution. General Design Our design has two systems: The Antimicrobial Peptide System, which produces the peptide LL-37; and The Resistance and Expulsion System which produces the MarA protein, which activates the arcAB & TolC operons, activating the arcAB & TolC efflux pump. Antimicrobial Peptide System H. pylori and other pathogenic bacteria produce AI-2, a quorum sensing molecule. This signal is detected by the pLsrA promoter (BBa_K117002), which allows the transcription of LL37 (BBa_K1230001), which is traduced and then translated into the antimicrobial peptide LL37. Once LL37 is expelled by the ArcAB-TolC efflux pump, it can act against H. pylori. Resistance & Expulsion System This system is induced by promoter LacI (BBa_R0010), which allows the transcription of marA gene (BBa_K1230000), producing the protein MarA. MarA acts on the arcAB and tolC operons, which activates de ArcAB-TolC efflux pump, allowing the expulsion of LL37 peptide. false false _1544_ 0 17080 9 Not in stock false LL-37 has the codon usage for humans. Using E. coli codon usage may inhibit protein function by wrong folding. false Andr??s Ferri??o Iriarte component2363830 1 BBa_K1230012 component2363812 1 BBa_K1230004 annotation2363812 1 BBa_K1230004 range2363812 1 1 619 annotation2363830 1 BBa_K1230012 range2363830 1 628 1741 BBa_K1230012 1 BBa_K1230012 rbs-GFP-terminator-pLsrA-LL37 2013-09-24T11:00:00Z 2015-05-08T01:09:44Z 2013 DNA distribution. Genscript. LL37 Generator under pLsrA promoter, with part BBa_E0840 as prefix. false false _1544_ 0 17080 9 Not in stock false This is an intermediate part. It can be used to produce an antimicrobial peptide in the presence of AI-2, a quorum-sensing molecule. false Andr??s Ferri??o Iriarte component2362475 1 BBa_K1230008 component2362479 1 BBa_K1230001 annotation2362479 1 BBa_K1230001 range2362479 1 995 1114 annotation2362475 1 BBa_K1230008 range2362475 1 1 988 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1702 1 RBS range1702 1 8 12 annotation1701 1 RBS-1\Strong range1701 1 1 15 BBa_K1230008 1 BBa_K1230008 rbs-GFP-Terminator- pLsrA 2013-09-24T11:00:00Z 2015-05-08T01:09:44Z 2013 DNA distribution. LL-37 antimicrobial peptide generator with codon usage for E. coli, under the arabinose promoter with a GFP generator. false false _1544_ 0 17080 9 Not in stock false LL-37 has the codon usage for E. coli, this could change the folding activities of the peptide. false Andr??s Ferri??o Iriarte component2362182 1 BBa_K117002 component2362181 1 BBa_E0840 annotation2362181 1 BBa_E0840 range2362181 1 1 878 annotation2362182 1 BBa_K117002 range2362182 1 887 988 BBa_E0840 1 GFP genera GFP generator 2004-10-17T11:00:00Z 2015-08-31T04:07:26Z Released HQ 2013 B0030.E0040.B0015 false true _11_1_ 0 61 7 In stock true true Jennifer Braff component1249242 1 BBa_E0040 component1249257 1 BBa_B0012 component1249247 1 BBa_B0010 component1249239 1 BBa_B0030 annotation1249247 1 BBa_B0010 range1249247 1 750 829 annotation1249257 1 BBa_B0012 range1249257 1 838 878 annotation1249242 1 BBa_E0040 range1249242 1 22 741 annotation1249239 1 BBa_B0030 range1249239 1 1 15 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1230000 1 MarA AcrAB-TolC multidrug efflux transport system activator from E. coli 2013-09-07T11:00:00Z 2015-05-08T01:09:44Z Synthesis from genscript The MarA protein acts as a transcriptional activator in E. coli, it allows the expression of the acrAB and tolC operons, which activate the AcrAB-TolC efflux pump, a mechanism that has been related with resistance to organic solvents, dyes, detergents, antibiotics such as chloramphenicol, tetracycline, novobiocin, erythromycin, fusidic acid and cloxacillin, as well as to cationic antimicrobial peptides, such as LL-37, HNP-2 and HBD-1. false false _1544_ 0 17080 9 It's complicated false Silent mutation (G->C) at base 132 to remove AarI and BspMI sites. false Andr??s Ferri??o Iriarte annotation2335365 1 MarA range2335365 1 1 393 annotation2335366 1 stop range2335366 1 388 393 annotation2335368 1 G to C mutation range2335368 1 132 132 annotation2335367 1 start range2335367 1 1 3 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_K117002 1 BBa_K117002 LsrA promoter (indirectly activated by AI-2) 2008-10-06T11:00:00Z 2015-05-08T01:09:34Z to be updated Released HQ 2013 The regulatory network for the uptake of Escherichia coli autoinducer 2 (AI-2) is comprised of a transporter complex, LsrABCD; its repressor, LsrR; and a cognate signal kinase, LsrK. This network is an integral part of the AI-2 quorum-sensing (QS) system. Once uptaken into the cell, AI-2 will be phosphorylated under the effect of LsrK. Without the presence of AI-2, LsrA promoter is inhibited by the repressor, LsrR. Phosphorylated AI-2 will prevent LsrR from inhibiting this promoter, hence activating it so that the downstream sequence can be expressed. To prevent the cell from self-inducing this promoter, we must suppress its AI-2 producing capability. It can be done by knocking out LuxS, one of the vital gene required for producing AI-2. By doing that, LsrA promoter can only be activated under the presence of AI-2 from other sources than the host cell which is LuxS mutant (say, by contact with normal cells). More information on AI-2 quorum-sensing (QS) system please refer to: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1952038 false false _209_ 0 2774 9 In stock true to be updated true Nguyen Xuan Hung annotation1979372 1 RBS BBa_B0034 range1979372 1 112 123 BBa_J04500 1 BBa_J04500 IPTG inducible promoter with RBS 2005-06-08T11:00:00Z 2015-08-31T04:08:14Z Davidson Synth-Aces Released HQ 2013 R0010.B0034 false true _16_ 0 326 16 In stock false false Kristen DeCelle component1508149 1 BBa_R0010 component1508159 1 BBa_B0034 annotation1508159 1 BBa_B0034 range1508159 1 209 220 annotation1508149 1 BBa_R0010 range1508149 1 1 200 BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_B0034_sequence 1 aaagaggagaaa BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_K1230008_sequence 1 attaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagcacaacatcaactgagtgcatgccttatttaatcatgtaactattcttacgacttcaaacgtcaaacagtcttaacacttatttaattaaaaagaggagaaa BBa_K117002_sequence 1 cacaacatcaactgagtgcatgccttatttaatcatgtaactattcttacgacttcaaacgtcaaacagtcttaacacttatttaattaaaaagaggagaaa BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1230012_sequence 1 attaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagcacaacatcaactgagtgcatgccttatttaatcatgtaactattcttacgacttcaaacgtcaaacagtcttaacacttatttaattaaaaagaggagaaatactagatgctgctgggtgatttcttccggaaatctaaagagaagattggcaaagagtttaaaagaattgtccagagaatcaaggattttttgcggaatcttgtacccaggacagagtcctaataa BBa_K1230000_sequence 1 atgacgatgtccagacgcaatactgacgctattaccattcatagcattttggactggatcgaggacaacctggaatcgccactgtcactggagaaagtgtcagagcgttcgggttactccaaatggcacctccaacggatgtttaaaaaagaaaccggtcattcattaggccaatacatccgcagccgtaagatgacggaaatcgcgcaaaagctgaaggaaagtaacgagccgatactctatctggcagaacgatatggcttcgagtcgcaacaaactctgacccgaaccttcaaaaattactttgatgttccgccgcataaataccggatgaccaatatgcagggcgaatcgcgctttttacatccattaaatcattacaacagctaataa BBa_K1230016_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagatgacgatgtccagacgcaatactgacgctattaccattcatagcattttggactggatcgaggacaacctggaatcgccactgtcactggagaaagtgtcagagcgttcgggttactccaaatggcacctccaacggatgtttaaaaaagaaaccggtcattcattaggccaatacatccgcagccgtaagatgacggaaatcgcgcaaaagctgaaggaaagtaacgagccgatactctatctggcagaacgatatggcttcgagtcgcaacaaactctgacccgaaccttcaaaaattactttgatgttccgccgcataaataccggatgaccaatatgcagggcgaatcgcgctttttacatccattaaatcattacaacagctaataatactagagattaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagcacaacatcaactgagtgcatgccttatttaatcatgtaactattcttacgacttcaaacgtcaaacagtcttaacacttatttaattaaaaagaggagaaatactagatgctgctgggtgatttcttccggaaatctaaagagaagattggcaaagagtttaaaagaattgtccagagaatcaaggattttttgcggaatcttgtacccaggacagagtcctaataa BBa_J04500_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaa BBa_B0030_sequence 1 attaaagaggagaaa BBa_K1230001_sequence 1 atgctgctgggtgatttcttccggaaatctaaagagaagattggcaaagagtttaaaagaattgtccagagaatcaaggattttttgcggaatcttgtacccaggacagagtcctaataa BBa_E0840_sequence 1 attaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1230004_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagatgacgatgtccagacgcaatactgacgctattaccattcatagcattttggactggatcgaggacaacctggaatcgccactgtcactggagaaagtgtcagagcgttcgggttactccaaatggcacctccaacggatgtttaaaaaagaaaccggtcattcattaggccaatacatccgcagccgtaagatgacggaaatcgcgcaaaagctgaaggaaagtaacgagccgatactctatctggcagaacgatatggcttcgagtcgcaacaaactctgacccgaaccttcaaaaattactttgatgttccgccgcataaataccggatgaccaatatgcagggcgaatcgcgctttttacatccattaaatcattacaacagctaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z