BBa_K123005 1 BBa_K123005 pTetBisdA 2008-10-27T12:00:00Z 2015-05-08T01:09:44Z Bisphenolics This part has been designed to allow the presence/absence of TetR to control the production of BisdA false false _241_ 0 2742 9 It's complicated false N/A false Jason Gardiner component1992749 1 BBa_K123000 component1992744 1 BBa_R0040 annotation1992749 1 BBa_K123000 range1992749 1 61 390 annotation1992744 1 BBa_R0040 range1992744 1 1 54 BBa_K123000 1 BisdA BisdA 2008-10-27T12:00:00Z 2015-05-08T01:09:44Z Sphingomonas sp. strain AO1 When used in conjunction with BisdB this enzyme can be used to degrade Bisphenol A. Activity has previously been recorded in E.coli by Miho Sasaki1 et al. 2005. Miho Sasaki1, Jun-ichi Maki, Ko-ichi Oshiman, Yoshinobu Matsumura1, and Tetsuaki Tsuchido.2005, Biodegradation of bisphenol A by cells and cell lysate from Sphingomonas sp. strain AO1. Biodegredation 16: 449-459 false false _241_ 0 2742 9 It's complicated true These parts where designed to include a his tag to make it easier to view enzyme presence true Jason Gardiner BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986787 1 -10 range1986787 1 43 48 annotation1986785 1 -35 range1986785 1 20 25 BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_K123000_sequence 1 atggccggccctcatatccaagtgactacccgcgatggggagatacgcgaactcgacgtcgcagcctccgggttcctgatggaagcccttcgcgacgccaatatcgacggcgtcgaggcgatgtgcggcggatgctgctcctgcgcgacctgccacgtctacatcgacgctgctcccgccgggaccctgccgccggtctcctccgacgaggagatgctgctttccggcctggtctcgacccccggacggtcgcggctctcctgccaaattccggtcacggccgaactggatggccttaagctcacgatcccgccggactccaccggttaa BBa_K123005_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagatggccggccctcatatccaagtgactacccgcgatggggagatacgcgaactcgacgtcgcagcctccgggttcctgatggaagcccttcgcgacgccaatatcgacggcgtcgaggcgatgtgcggcggatgctgctcctgcgcgacctgccacgtctacatcgacgctgctcccgccgggaccctgccgccggtctcctccgacgaggagatgctgctttccggcctggtctcgacccccggacggtcgcggctctcctgccaaattccggtcacggccgaactggatggccttaagctcacgatcccgccggactccaccggttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z