BBa_K1231002 1 BBa_K1231002 Lpp-RBS is a constitutive promoter 2013-09-16T11:00:00Z 2015-05-08T01:09:44Z Used PCR to extract the promoter from a plasmid obtained from Northwestern University's Jewett Lab. Lpp-RBS is a constitutive promoter that is constantly initiating transcription at low levels. false false _1545_ 0 18772 9 In stock false N/A false Brendan Tran BBa_K1231002_sequence 1 ggtttcccgactggaatcaaaaaaatattctcaacataaaaaactttgtgtaatacttgtgaaataattttgtttaactttaagaaggag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z