BBa_K124014 1 BBa_K124014 Bacteriophage Holin Gene pS105 2008-10-08T11:00:00Z 2015-05-08T01:09:44Z This part was graciously donated to the Brown iGEM Team by Ry Young at Texas A&M. The Cell Lysis Cassette consists of an S, R, and Rz protein. When paired with an activator, the cassette is expressed and cell lysis is induced. The S105 strain of the cassette has the initial 6 base pairs at the beginning of the wild type sequence removed. This causes cell lysis to be induced at a faster rate than the wild type. false false _221_ 0 3367 9 It's complicated true No design considerations. true Katherine Jacobs BBa_K124014_sequence 1 gctgctaaaaaagccggagtagaagatggtagaaatcaataagcaatctcgcttatataacgagcgtgtttatcggctacatcggtactgactcgattggttcgcttatcaaacgcttctataatggcggtgcgtttacaaaaacagtaatcgacgcaacgatgtgcgccattatcgcctggttcattcgtgaccttctcgacttcgccggactaagtatgccagaaaaacatgacctgttggccgccattctcgcggcaaaggaacaaggcatcggggcaatccttgcgtttgcaatggcgtaccttcgcggcaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z