BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation1702 1 RBS range1702 1 8 12 BBa_K125100 1 BBa_K125100 nir promoter from <I>Synechocystis</I> sp. PCC6803 2008-07-23T11:00:00Z 2015-05-08T01:09:44Z The ''nirA'' promoter originates from ''Synechocystis'' sp. PCC6803. The ''nir'' promoter is nitrate inducible. false false _ 0 3229 9 It's complicated false false Krystle Salazar and Grace Kwan annotation1968489 1 Ntc-A binding motif range1968489 1 36 44 annotation1968488 1 Ntc-B binding motif range1968488 1 5 20 annotation1968487 1 -10 sequence range1968487 1 73 78 annotation1968486 1 nir promoter range1968486 1 1 88 BBa_K125110 1 BBa_K125110 nir promoter + rbs (0.6) 2008-10-27T12:00:00Z 2015-05-08T01:09:44Z nir was derived from ''Synechocystis'' sp. PCC 6803 and the rbs is that entered in the registry. The cyanobacterial ''nir'' promoter was ligated to an rbs. false false _179_ 0 3229 9 It's complicated false n/a false Grace Kwan component1992517 1 BBa_B0030 component1992515 1 BBa_K125100 annotation1992515 1 BBa_K125100 range1992515 1 1 88 annotation1992517 1 BBa_B0030 range1992517 1 97 111 BBa_B0030_sequence 1 attaaagaggagaaa BBa_K125100_sequence 1 gctaaatgcgtaaactgcatatgccttcgctgagtgtaatttacgttacaaattttaacgaaacgggaaccctatattgatctctact BBa_K125110_sequence 1 gctaaatgcgtaaactgcatatgccttcgctgagtgtaatttacgttacaaattttaacgaaacgggaaccctatattgatctctacttactagagattaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z