BBa_K125310 1 slr2016 SS slr2016 signal sequence from cyanobacterium Synechocystis; secretes protein 2008-07-24T11:00:00Z 2015-05-08T01:09:44Z The ''slr2016'' signal sequence is located at the amino terminus of slr2016 polypeptides synthesized by ''Synechocystis'' sp. PCC 6803. false false _179_ 0 3229 9 In stock false false Krystle Salazar and Grace Kwan annotation1968259 1 slr2016 signal sequence range1968259 1 1 53 BBa_K125310_sequence 1 tggcagcaaaacaactatggaaaattttcaatcctagaccgatgaagggtgga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z