BBa_K125320 1 OriT-RP4 OriT-RP4 (Origin of transfer for the RP4 plasmid) 2008-08-28T11:00:00Z 2015-05-08T01:09:45Z RP4 NCBI accession number NC_001621 Relaxation region of self-transmissible plasmid RP4. When this part is added to a plasmid, it is transferred by RP4 through conjugation. false false _179_ 0 3138 9 It's complicated false This part is similar to [[Part:BBa_J01003|J01003]], which has no experience and is much longer. In the process of designing and testing this part, it will be compared to J01003. false Margaret Ruzicka BBa_K125320_sequence 1 gaataagggacagtgaagaaggaacacccgctcgcgggtgggcctacttcacctatcctgcccggctgacgccgttggatacaccaaggaaagtctaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z