BBa_J33207 1 BBa_J33207 lac promoter and lacZ 2006-10-26T11:00:00Z 2015-08-31T04:08:46Z The DNA was amplified from E. coli BL21 genomic DNA using primers based on published sequence (Genbank accession J01636, gi:146575). The annotation shown here is based on that associated with this Genbank entry. The sequence shown here is derived by sequencing the construct. This part (submitted in pSB1A2) consists of the lac promoter and lacZ' gene, encoding the N-terminal 76 amino acid residues of LacZ, sufficient to complement the lacZ-delta-M15 mutation for blue-white selection on Xgal plates. A SacI site has been introduced at the 3' end, overlapping the XbaI site of the Biobrick prefix. This is designed to be used as a cloning vector for making new biobricks. PCR primers can be designed with a SacI site in one primer and an SpeI site in the other. This removes the necessity for an excessively long non-complementary tail on one primer bearing either the full biobrick prefix or suffix. The PCR product can then be digested with SacI and SpeI for insertion into this plasmid, replacing the Plac-lacZ' cassette. Recombinant plasmids will then be white on IPTG/Xgal plates, whereas any that still contain the original insert will be blue. We have used this strategy to prepare several biobricks, including BBa_J33204, which contains the xylE gene encoding catechol-2,3-dioxygenase. (For making biobricks that contain lacZ', BBa_J33204 can be used in the same way; in this case, clones with plasmids that still contain xylE will turn yellow on addition of a drop of 10 mM catechol.) false false _63_ 0 837 63 It's complicated true Note that the SacI site overlaps the SpeI site. The Biobrick prefix ends ...TCTAGAG. When this is added to the CTC at the start of the sequence shown here, the SacI site, GAGCTC, is generated. false Chris French annotation1907858 1 lacZ' range1907858 1 370 600 annotation1907854 1 SacI range1907854 1 1 3 annotation1907857 1 rbs range1907857 1 359 362 annotation1907859 1 -10 range1907859 1 320 325 annotation1907855 1 CAP binding site range1907855 1 248 285 annotation1907860 1 -35 range1907860 1 297 302 annotation1907856 1 LacI binding site range1907856 1 332 352 BBa_K125360 1 oriT/LacZ oriT with lac promoter and lacZ 2008-10-27T12:00:00Z 2015-05-08T01:09:45Z The oriT sequence was taken from the self-transmissible plasmid RP4. [[Part:BBa_J33207|LacZ]] is available as a part in the registry. This part was constructed to compare the [[Part:BBa_J01003|oriTr]], which is currently available in the registry to [[Part:BBa_K125320|oriT]] which was recently designed to perform the same function. The oriTr was added to [[Part:BBa_J33207|LacZ]] part so that conjugation could be monitored by blue/white selection. false false _179_ 0 3138 9 It's complicated false The oriT was synthesized and J33207 was extracted from the registry. false Margaret Ruzicka component1992572 1 BBa_K125320 component1992571 1 BBa_J33207 annotation1992571 1 BBa_J33207 range1992571 1 1 600 annotation1992572 1 BBa_K125320 range1992572 1 609 707 BBa_K125320 1 OriT-RP4 OriT-RP4 (Origin of transfer for the RP4 plasmid) 2008-08-28T11:00:00Z 2015-05-08T01:09:45Z RP4 NCBI accession number NC_001621 Relaxation region of self-transmissible plasmid RP4. When this part is added to a plasmid, it is transferred by RP4 through conjugation. false false _179_ 0 3138 9 It's complicated false This part is similar to [[Part:BBa_J01003|J01003]], which has no experience and is much longer. In the process of designing and testing this part, it will be compared to J01003. false Margaret Ruzicka BBa_K125320_sequence 1 gaataagggacagtgaagaaggaacacccgctcgcgggtgggcctacttcacctatcctgcccggctgacgccgttggatacaccaaggaaagtctaca BBa_J33207_sequence 1 ctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtgaaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtga BBa_K125360_sequence 1 ctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtgaaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtgatactagaggaataagggacagtgaagaaggaacacccgctcgcgggtgggcctacttcacctatcctgcccggctgacgccgttggatacaccaaggaaagtctaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z