BBa_K1255000 1 nhaS nhaS gene that express NhaS, a putative sodium ion binding protein. 2014-06-12T11:00:00Z 2015-05-08T01:09:45Z NhaS comes from Bacillus Firmus. "NhaS is proposed to be a sodium binding protein that can enhance the Na+ -resistance of antiporter- deficient strains by increasing the availability of Na+ to the integral membrane antiporters on the cytoplasmic side of the membrane and by sequestering Na+ while rate-limiting efflux mechanisms catalyze extrusion of the cation." (Krulwich et al. 1994) "The NhaS protein enhances resistance of bacteria into which the nhaS gene has been introduced, to Na+ by sequestering Na+ and reducing its cytotoxicity." (Krulwich et al. 1994) NhaS is protein that binds to sodium ions and enhance the bacteria's resistance up to 15% to high saline conditions. false false _1611_ 0 19636 9 Not in stock false The original genomic sequence was optimized for expression in E. coli. IVEY Mark, KRULWICH Terry. (1994) Sodium ion binding proteins. From http://www.google.com.mx/patents/US5346815. false Fernanda Puente, Marina Emilio annotation2379058 1 nhaS range2379058 1 1 207 BBa_K1255000_sequence 1 atgaccatgttctctcgtctgattagcatcgtgagcctgattctgtccttctacttcgcttacaaataccgttatcgtgtgattaacgcggtgctgggccgtcgctggctgcgtaaagttattatcggttttgccatgcagattccgatgattcgtgaccgtatgctgggtagcgttctgcaaagtaaccgtccgcaaaatgtgtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z