BBa_K1255002 1 pUV + NhaS NhaS with an RFP reporter induced by an UV promoter. 2014-06-15T11:00:00Z 2015-05-08T01:09:45Z RFP comes from <i>Discosoma striata</i> (coral) and NhaS from <i>Bacillus firms</i> NhaS with an RFP reporter induced by an UV promoter. This device is activated when UV promoter (BBa_I765001) is exposed to 360nm of UV irradiation. It produces a gene called NhaS (BBa_K1255000) that is a sodium ion binding protein and reports its function with a red fluorescence reporter. (BBa_E1010) It contains an RBS (BBa_B0034) before its genes. false false _1611_ 0 19659 9 It's complicated false NhaS (BBa_K1255000) sequence was optimized for its expression in <i>E. coli</i> false Fernanda Puente, Marina Emilio component2379123 1 BBa_B0034 component2379127 1 BBa_B0034 component2379121 1 BBa_I765001 component2379125 1 BBa_K1255000 component2379130 1 BBa_E1010 annotation2379127 1 BBa_B0034 range2379127 1 318 329 annotation2379123 1 BBa_B0034 range2379123 1 85 96 annotation2379121 1 BBa_I765001 range2379121 1 1 76 annotation2379130 1 BBa_E1010 range2379130 1 336 1041 annotation2379125 1 BBa_K1255000 range2379125 1 103 309 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_E1010 1 mRFP1 **highly** engineered mutant of red fluorescent protein from Discosoma striata (coral) 2004-07-27T11:00:00Z 2015-08-31T04:07:26Z Campbell et al., PNAS v99 p7877 <a href="http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=12060735">URL</a> Released HQ 2013 monomeric RFP: Red Fluorescent Protein. Excitation peak: 584 nm Emission peak: 607 nm false false _11_1_ 0 52 7 In stock false TAATAA double stop codon added (DE). Four silent mutations made to remove three EcoRI sites and one PstI site: A28G, A76G, A349G, G337A. true Drew Endy annotation1014044 1 mrfp1 range1014044 1 1 675 annotation2214014 1 Help:Barcodes range2214014 1 682 706 BBa_I765001 1 pUV UV promoter 2007-10-25T11:00:00Z 2015-08-31T04:08:09Z Genomic sequence This device is regulated by UV irradiation false false _118_ 0 2266 9 In stock false None true iGEM Colombian Team 2007 annotation1955941 1 promoter range1955941 1 1 76 BBa_K1255000 1 nhaS nhaS gene that express NhaS, a putative sodium ion binding protein. 2014-06-12T11:00:00Z 2015-05-08T01:09:45Z NhaS comes from Bacillus Firmus. "NhaS is proposed to be a sodium binding protein that can enhance the Na+ -resistance of antiporter- deficient strains by increasing the availability of Na+ to the integral membrane antiporters on the cytoplasmic side of the membrane and by sequestering Na+ while rate-limiting efflux mechanisms catalyze extrusion of the cation." (Krulwich et al. 1994) "The NhaS protein enhances resistance of bacteria into which the nhaS gene has been introduced, to Na+ by sequestering Na+ and reducing its cytotoxicity." (Krulwich et al. 1994) NhaS is protein that binds to sodium ions and enhance the bacteria's resistance up to 15% to high saline conditions. false false _1611_ 0 19636 9 Not in stock false The original genomic sequence was optimized for expression in E. coli. IVEY Mark, KRULWICH Terry. (1994) Sodium ion binding proteins. From http://www.google.com.mx/patents/US5346815. false Fernanda Puente, Marina Emilio annotation2379058 1 nhaS range2379058 1 1 207 BBa_K1255002_sequence 1 ggcaggaagaccgggcgcatgagcgtattttgtttatctaatatgcctgaaagcgcataccgctatggagggggtttactagagaaagaggagaaatactagatgaccatgttctctcgtctgattagcatcgtgagcctgattctgtccttctacttcgcttacaaataccgttatcgtgtgattaacgcggtgctgggccgtcgctggctgcgtaaagttattatcggttttgccatgcagattccgatgattcgtgaccgtatgctgggtagcgttctgcaaagtaaccgtccgcaaaatgtgtaatactagagaaagaggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc BBa_B0034_sequence 1 aaagaggagaaa BBa_E1010_sequence 1 atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc BBa_K1255000_sequence 1 atgaccatgttctctcgtctgattagcatcgtgagcctgattctgtccttctacttcgcttacaaataccgttatcgtgtgattaacgcggtgctgggccgtcgctggctgcgtaaagttattatcggttttgccatgcagattccgatgattcgtgaccgtatgctgggtagcgttctgcaaagtaaccgtccgcaaaatgtgtaa BBa_I765001_sequence 1 ggcaggaagaccgggcgcatgagcgtattttgtttatctaatatgcctgaaagcgcataccgctatggagggggtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z